Sequences

BGISUSX0000018327

Source Seq Type : all

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>BGISUSX0000018327
GTTGGCCGAGTTCTGTCTGGTTCTTGTAACATAATCCAAGATCTTGGAGGTGGTTGTTCTGTTGAAA

Assemble


-----------------------------------------------------------------------------------------
BGISUSX0000018327   : GTTGGCCGAGTTCTGTCTGGTTCTTGTAACATAATCCAAGATCTTGGAGGTGGTTGTTCTGTTGAAA
CT394718            : CCACAAGCTGCAGCATAGGTTGCAGATGCGGCTTGGATCTGGTGTGGCTGAAGGCTGTGGTGTAAGT

Cited by

ENST00000261951