Sequences

BGISUSX0000026982

Source Seq Type : all

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>BGISUSX0000026982
CGGGCTCGCACCGACGAGGCAACTGCCACAGGAAGCCGCTCCGAGGCGGAGGATGAGGACGATGAGGATTATGTACCCTACGTACCACTGCGACAGCGCC
GGCAGTTGCTG

Assemble


--------------------------------------------------------------------------------------------------------------------------
BGISUSX0000026982   : CGGGCTCGCACCGACGAGGCAACTGCCACAGGAAGCCGCTCCGAGGCGGAGGATGAGGACGATGAGGATTATGTACCCTACGTACCACTGCGACAGCGCC
DV226438            : CGGGCTCGCACCGACGAGGCAACTGCCACAGGAAGCCGCTCCGAGGCGGAGGATGAGGACGATGAGGATTATGTACCCTACGTACCACTGCGACAGCGCC

---------------------------------
BGISUSX0000026982   : GGCAGTTGCTG
DV226438            : GGCAGTTGCTG

Cited by

ENST00000330503