Sequences

BGISUSX0000026995

Source Seq Type : all

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>BGISUSX0000026995
TTCAGCCTTCTCTTGAGGTGCTGGTGCTGATCCAGAAGGCTGACGTTGGACTGAGGGCCCAGCGGGATGTCGTCCTCATCTCCTCGGGGTTCGCTGCCGC
TGTCCTGCTGCTCCTCTTCCGCAGCTCCCTTGCGCCTTCGCTGAAGCAGCTTCTGGAG

Assemble


--------------------------------------------------------------------------------------------------------------------------
BGISUSX0000026995   : TTCAGCCTTCTCTT*GAGGTGCTGGTGCTGATCCAGAAGGCTGACGTTGGACTGAGGGCCCAGCGGGATGTCGTCCTCATCTCCTCGGGGTTCGCTGCCG
DV226438            : CATGNCNCNNNNNNtGAGAATGGTGGGANNNNNNTNNNNCTGAATGGGTGTTGGGTGGTGGATGNNNNNCTTCTTTAGGNNTCTCAGGATGGCTGCAGGA
rbye_77376.y1       : TTCAGCCTTCTCTT*GAGGTGCTGGTGCTGATCCAGAAGGCTGACGTTGGACTGAGGGCCCAGCGGGATGTCGTCCTCATCTCCTCGGGGTTCGCTGCCG
bdf_74693.z1        : -----------------------------------------------TGGACTGAGGGCCCAGCGGGATGTCGTCCTCATCTCCTCGGGGTTCGCTGCCG

---------------------------------------------------------------------------------
BGISUSX0000026995   : CTGTCCTGCTGCTCCTCTTCCGCAGCTCCCTTGCGCCTTCGCTGAAGCAGCTTCTGGAG
DV226438            : AATTTCATTTCCTTGAAACTCTTGATGGGTGGTGGGATCCCATCACCTTCCACCAAGAt
rbye_77376.y1       : CTGTCCTGCTGCTCCTCTTCCGCAGCTCCCTTGCGCCTTCGCTGAAGCAGCTTCTGGAG
bdf_74693.z1        : CTGTCCTGCTGCTCGTGTTCCGCAGCTCCCTTGCGCCTTCGCTGAAGCAGCTTCTGGAg

Cited by

ENST00000330503