Sequences

BGISUSX0000027029

Source Seq Type : all

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>BGISUSX0000027029
ATTCTCTCAGGCCGAGACATGATAGGCATTGCCTTCACGGGTTCAGGCAAGACACTGGTGTTCACCCTGCCCGTCATCATGTTCTGCCTGGAACAAGAGA
AGAGGTTACCTTTCTCTAAGCGCGAAGGGCCCTATGGACTCATTATCTGCCCCTCG

Assemble


--------------------------------------------------------------------------------------------------------------------------
BGISUSX0000027029   : ATTCTCTCAGGCCGAGACATGATAGGCATTGCCTTCACGGGTTCAGGCAAGACACTGGTGTTCACCCTGCCCGTCATCATGTTCTGC*CTGGAACAAGAG
rcad08b_o21.y1      : ATTCTCTCAGGCCGAGACATGATAGGCATTGCCTTCACGGGTTCAGGCAAGACACTGGTGTTCACCCTGCCCGTCATCATGTTCTGC*CTGGAACAAGAG
CK455133            : --------------------GATAGGCATTGCCTTCACGGGTTCAGGCAAGACACTGGTGTTCACCCTGCCCGTCATCATGTTCTGC*CTGGAACAAGAG
reye1630b_k3r1.y1   : ------------------------GGCATTGCCTTCACGGGTTCAGGCAAGACACTGGTGTTCACCCTGCCCGTCATCATGTTCTGCgCGGGAACAAGAG

-------------------------------------------------------------------------------
BGISUSX0000027029   : AAGAGGTTACCTTTCTCTAAGCGCGAAGGGCCCTATGGACTCATTATCTGCCCCTCG
rcad08b_o21.y1      : AAGAGGTTACCTTTCTCTAAGCGCGAAGGGCCCTATGGACTCATTATCTGCCCCTCG
CK455133            : AAGAGGTTACCTTTCTCTAAGCGCGAAGGGCCCTATGGACTCATTATCTGCCCCTCG
reye1630b_k3r1.y1   : AAGAGGTTACCTTTCTCTAAGCGCGAAGGGCCCTATGGACTCATTATCTGCCCCTCg

Cited by

ENST00000330503