Sequences

BGISUSX0000027039

Source Seq Type : all

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>BGISUSX0000027039
CATGGCGTGCACATGATGGTGGCCACACCTGGGCGCCTCATGGATCTGCTGCAGAAGAAGATGGTCAGCCTGGACATCTGCCGTTACCTGGCCCTGGATG
AGGCTGACCGCATGATCGACATGGGTTTTGAGGGCGACATCCGTACCATCTTCTCCTACTTCAAG

Assemble


--------------------------------------------------------------------------------------------------------------------------
BGISUSX0000027039   : CATGGCGTGCACATGATGGTGGCCACACCTGGGCGCCTCATGGATCTGCTGCAGAAGAAGATGGTCAGCCTGGACATCTGCCGTTACCTGGCCCTGGATG
rpigca0_001577.y1   : CATGGCGTGCACATGATGGTGGCCACACCTGGGCGCCTCATGGATCTGCTGCAGAAGAAGATGGTCAGCCTGGACATCTGCCGTTACCTGGCCCTGGATG
CK455133            : GATAGGCATTGCCTTCACGGGTTCAGGCAAGACACTGGTGTTCACCCTGCCCGTCATCATGTTCTGCCTGGAACAAGAGAAGAGGTTACCTTTCTCTAAG

---------------------------------------------------------------------------------------
BGISUSX0000027039   : AGGCTGACCGCATGATCGACATGGGTTTTGAGGGCGACATCCGTACCATCTTCTCCTACTTCAAG
rpigca0_001577.y1   : AGGCTGACCGCATGa@@------------------------------------------------
CK455133            : CGCGAAGGGCCCTATGGACTCATTATCTGCCCCTCGCGGGAGCTGGCCCGGCAGACCCACGGCAt

Cited by

ENST00000330503