Sequences

BGISUSX0000027079

Source Seq Type : all

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>BGISUSX0000027079
TCCAATGTCCAGCATGGACTCGTCTCCACAGTGTAGCACTTGCAGCACAGGTGGAACTTTCTGCTTGGCCTCCAGCAGCAGGGCTTTGAGGTCCATCAGC
ACTGACTCATC

Assemble


--------------------------------------------------------------------------------------------------------------------------
BGISUSX0000027079   : TCCAATGTCCAGCATGGACTCGTCTCCACAGTGTAGCACTTGCAGCACAGGTGGAACTTTCTGCTTGGCCTCCAGCAGCAGGGCTTTGAGGTCCATCAGC
CB474250            : CCAAAAAGGCTTGTGCTTTAATCGTAGCTAGGGTAAAGGGGAGCAAAAATAGTAATTCCAGGGAGCACAGGGAGCAGGTAgccaggtccagcctggccca
CB482975            : TGGCGTGTTGGGTAGTCGATGTAGCCCCAGGGATGTAGGCCCCTTGGAGAGAAGGGCGGATGACACCTGGCTCAGAAGTCcatgagctgtgggccaggta
BI467535            : GAGACCAGAAAGGCTTGTGCTTTAATCGTAGCTAGGGTAAAGGGGAGCAAAAATAGTAATTCCAGGGAGCACAGGGAGCAGGTAGCCAGGTCCAGcctgg
CB469932            : AGCCTGGCCCAACCCAGGCCAGCTGGGCCAAAGATGCCAATGTCTTGTTCATGGGGCTGGCGTGTTGGGGAGGCGGATGGAGCCCCAGGGATGGAGGCCC
CF179995            : TTTTTGGGACCAGAAAGCTTGTGCTTTAATCGTAGCTAGGGTAAAGGGGAGCAAAAATAGTAATTCCAGGGAGCACAGGGAGCAGGTAGCCAGGTCCAGC

---------------------------------
BGISUSX0000027079   : ACTGACTCATC
CB474250            : acccaggccag
CB482975            : gtccttgcggc
BI467535            : cccaacccagg
CB469932            : CTTGGAGAGAa
CF179995            : CTGGCCCAACc

Cited by

ENST00000330503