Sequences

BGISUSX0000042359

Source Seq Type : all

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>BGISUSX0000042359
CAAGCGCACTCATGAAACAACCGCCTATTCAGTCTACGGCTGGGGCCGTCCCGGTTCGCAATGAGAAA

Assemble


------------------------------------------------------------------------------------------
BGISUSX0000042359   : CAAGCGCACTCATGAAACAACCGCCTATTCAGTCTACGGCTGGGGCCGTCCCGGTTCGCAATGAGAAA
CB287203            : TTCTATCAGTACGCAGCAGTGTCCAGTGGCCTCTGGTGCGGAGGATTTTCTGTTCGTTGACGTTGTAc
CF722642            : TTCTATCAGTACGCAGCAGTGTCCAGTGGCCTCTGGTGCGGAGGATTTTCTGTTCGTTGACGTTGTAc
rbd_82170.y1        : CAAGCGCACTCATGAAACAACCGCCTATTCAGTCTACGGCTGGGGCCGTCCCGGTTCGCAATGAGAAa
rpfat_12102.y1      : ---------------aGCAACCGCCTATTCAGTCTACGGCTGGGGCCGTCCCGGTTCGCAATGAGAAa

Cited by

ENST00000267812