Sequences

BGISUSX0000042364

Source Seq Type : all

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>BGISUSX0000042364
GGTGAGATTTCGATGGAAAAAGTGAAGGTAAAACGTTATGTGTCAGGAAAGAGGCCAGACTATGCCCCTATGGAGTCCTCAGATGAGGAGGATGAAGAAT
TTCAGTTCATTAAGAAAGCCAAAGAACAAGAAGCAGAGCCTGAGGAACAAGAGGAGGATTCATCTAGTGACCCTCGGCTGCGACGTTTGCAGAACCGTAT
TAGTGAAGATGTGGAAGAG

Assemble


--------------------------------------------------------------------------------------------------------------------------
BGISUSX0000042364   : GGTGAGATTTCGATGGAAAAAGTGAAGGTAAAACGTTATGTGTCAGGAAAGAGGCCAGACTATGCCCCTATGGAGTCCTCAGATGAGGAGGATGAAGAAT
BW957003            : TAAGTGGTGTTTCTATCAGTACGCAGCAGTGTCCAGTGGCCTCTGGTGCGGAGGATTTTCCGTTCGTTGACGTTGTACCTGTTCACAGTTTGGAATCAGT
CB287203            : caCGCGTCCGTTCTATCAGTACGCAGCAGTGTCCAGTGGCCTCTGGTGCGGAGGATTTTCTGTTCGTTGACGTTGTACCTGTTCACAGTTTGGAATCAGT
bdd_38786.z1        : -----------------------------AAAACGTTATGTGTCAGGAAAGAGGCCAGACTATGCCCCTATGGAGTCCTCAGATGAGGAGGATGAAGAAT
BW973103            : -------------------------------------------------------------------CTATGGAGTCCTCAGATGAGGAGGATGAAGAAT
CV869648            : ----------------------------------------------------------------------------------------------------
rcbr0_016177.y1     : ----------------------------------------------------------------------------------------------------
rcbr0_011016.y1     : ----------------------------------------------------------------------------------------------------
rcbr0_016178.y1     : ----------------------------------------------------------------------------------------------------
rcbr0_011347.y1     : ----------------------------------------------------------------------------------------------------

--------------------------------------------------------------------------------------------------------------------------
BGISUSX0000042364   : TTCAGTTCATTAAGAAAGCCAAAGAACAAGAAGCAGAGCCTGAGGAACAAGAGGAGGATTCATCTAGTGACCCTCGGCTGCGACGTTTGCAGAACCGTAT
BW957003            : CAAGTTTTGGAATCACCGCCGCTGCCATCAAAATGTCGGTCCCAAGCGCACTCATGAAACAACCGCCTATTCAGTCTACGGCTGGGGTCGTCCCGGTTCG
CB287203            : CAAGTTTTGGAATCACCGCCGCTGCCATCAAAATGTCGGTCCCAAGCGCACTCATGAAACAACCGCCTATTCAGTCTACGGCTGGGGTCGTCCCGGTTCG
bdd_38786.z1        : TTCAGTTCATTAAGAAAGCCAAAGAACAAGAAGCAGAGCCTGAGGAACAAGAGGAGGATTCATCTAGTGACCCTCGGCTGCGACGTTTGCAGAACCGTAT
BW973103            : TTCAGTTCATTAAGAAAGCCAAAGAACAAGAAGCAGAGCCTGAGGAACAAGAGGAGGATTCATCTAGTGACCCTCGGCTGCGACGTTTGCAGAACCGTAT
CV869648            : ----------------------------------------------------GGAGGATTCATCTAGTGACCCTCGGCTGCGACGTTTGCAGAACCGTAT
rcbr0_016177.y1     : --------------------------------------------------------------------------CGGCTGCGACGTTTGCAGAACCGTAT
rcbr0_011016.y1     : --------------------------------------------------------------------------CGGCTGCGACGTTTGCAGAACCGTAT
rcbr0_016178.y1     : --------------------------------------------------------------------------CGGCTGCGACGTTTGCAGAACCGTAT
rcbr0_011347.y1     : --------------------------------------------------------------------------CGGCTGCGACGTT*GCAGAACCGTAT

-----------------------------------------
BGISUSX0000042364   : TAGTGAAGATGTGGAAGAG
BW957003            : CAATGAGAAAGGTGAGATt
CB287203            : CAATGAGAAAGGCGAGATt
bdd_38786.z1        : TAGTGAAGATGTGGAAGAg
BW973103            : TAGTGAAGATGTGGAAGAg
CV869648            : TAGTGAAGATGTGGAAGAg
rcbr0_016177.y1     : TAGTGAAGATGTGGAAGAg
rcbr0_011016.y1     : TAGTGAAGATGTGGAAGAg
rcbr0_016178.y1     : TAGTGAAGATGTGGAAGAg
rcbr0_011347.y1     : TAGTGAAGATGTGGAAGAG

Cited by

ENST00000267812