Sequences

BGISUSX0000042398

Source Seq Type : all

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>BGISUSX0000042398
GAAATAGAGCGACGCCGTGGCATGATGCGTCAACGAGCACAGGAGAGAAAAAATGAAGAGATGGAAGTCATGGAGGTGGAAGATGAGGGGCGTTCTGGGG
AGGAGTCAGAATCAGAGTCTGAGTATGAAGAGTACACAGACAGTGAAGATGAGATGGAGCCTCGCCTTAAGCCAGTCTTCATTCG

Assemble


--------------------------------------------------------------------------------------------------------------------------
BGISUSX0000042398   : GAAATAGAGCGACGCCGTGGCATGATGCGTCAACGAGCACAGGAGAGAAAAAATGAAGAGATGGAAGTCATGGAGGTGGAAGATGAGGGGCGTTCTGGGG
BW961768            : TGTTTCTATCAGTACGCAGCAGTGTCCAGTGGCCTCTGGTGCGGAGGATTTTCTGTTCGTTGACGTTGTACCTGTTCACAGTTTGGAATCAGTCAAGTTT
rjca34c_g20.y1      : GAAATAGAGCGACGCCGTGGCATGATGCGTCAACGAGCACAGGAGAGAAAAAATGAAGAGATGGAAGTCATGGAGGTGGAAGATGAGGGGCGTTCTGGGG
BP436657            : AATCAGTACGCAGCAGTGTCCAGTGGCCTCTGGTGCGGAGGATTTTCTGTTCGTTGACGTTGTACCTGTTCACAGTTTGGAATCAGTCAAGTTTTGGAAT
BW957003            : TAAGTGGTGTTTCTATCAGTACGCAGCAGTGTCCAGTGGCCTCTGGTGCGGAGGATTTTCCGTTCGTTGACGTTGTACCTGTTCACAGTTTGGAATCagt
rcbr0_014786.y1     : GAAATAGAGCGACGCCGTGGCATGATGCGTCAACGAGCACAGGAGAGAAAAAATGAAGAGATGGAAGTCATGGAGGTGGAAGATGAGGGGCGTTCTGGGG
CX062143            : CCACGCGTCCGGCCGCTGCCATCAAAATGTCGGTCCCAAGCGCACTCATGAAACAACCGCCTATTCAGTCTACGGCTGGGGCCGTCCCGGTTCGCAATGA
BP164346            : TTTTCTAGCTCAGCCGTAAGTGGTGTTTCTATCAGTACGCAGCAGTGTCCAGTGGCCTCTGGTGCGGAGGATTTTCTGTTCGTTGACGTTGTACCTGTTC
CF363535            : GATTGGCTCGACATCGGAAAATAGTGGAACCCGAAGTGGTGGGAGAAAGTGACTCATAAGTAGAAGGAGATGCTTGGCGCATGGAACGAGAAGATACCAG
BP440238            : TTTTCTAGCTCAGCCGTAAGTGGTGTTTCTATCAGTACGCAGCAGTGTCCAGTGGCCTCTGGTGCGGAGGATTTTCTGTTCGTTGACGTTGTACCTGTTC
BW973103            : CTATGGAGTCCTCAGATGAGGAGGATGAAGAATTTCAGTTCATTAAGAAAGCCAAAGAACAAGAAGCAGAGCCTGAGGAACAAGAGGAGGATTCATCTAG
AJ656997            : -----------------------------------------------------------GATGGAAGTCATGGAGGTGGAAGATGAGGGGCGTTCTGGGG
rcsk15_i2.y1        : ----------------------------------------------------------------------------------------------------
rdbla0116_j13.y1    : ----------------------------------------------------------------------------------------------------
CX065344            : ----------------------------------------------------------------------------------------------------

-----------------------------------------------------------------------------------------------------------
BGISUSX0000042398   : AGGAGTCAGAATCAGAGTCTGAGTATGAAGAGTACACAGACAGTGAAGATGAGATGGAGCCTCGCCTTAAGCCAGTCTTCATTCG
BW961768            : TGGAATCACCGCCGCTGCCATCAAAATGTCGGTCCCAAGCGCACTCATGAAACAAccgcctattcagtctacggctggggccgtc
rjca34c_g20.y1      : AGGAGTc@@----------------------------------------------------------------------------
BP436657            : CACCGccgctgccatcaaaatgtcggtcccaagcgcactcatgaaacaaccgcctattcagtctacggctggggccgtcccggtt
BW957003            : caagttttggaatcaccgccgctgccatcaaaatgtcggtcccaagcgcactcatgaaacaaccgcctattcagtctacggctgg
rcbr0_014786.y1     : AGGAGTCAGAATCAGAGTCTGAGTATg@@--------------------------------------------------------
CX062143            : GAAAGGCGAGATTTCGATGGAAAAAGTGAAGGTAAAACGTTATGTGTCAGGAAAGAGGCCAGACTATGCCCCTATGGAGTCCTCa
BP164346            : ACAGTTTGGAATCAGTCAAGTTTTGGAATCACCGCCGCTGCCATCAAAATGTCGGTCCCAAGCGCACTCATGAAACAACCGCcta
CF363535            : TGAAGAAGAAGAAGAAGAGATTGATGATGAGGAAATAGAGCGACGCCGTGGCATGATGCGTCAACGAGCACAGGAGAGAAAAAAt
BP440238            : ACAGTTTGGAATCAGTCAAGTTTTGGAATCACCGCCGCTGCCATCAAAATGTCGGTCCCAAGCGCACTCATGAAACAACCGCCTa
BW973103            : TGACCCTCGGCTGCGACGTTTGCAGAACCGTATTAGTGAAGATGTGGAAGAGAGATTGGCTCGACATCGGAAAATAGTGGAACCc
AJ656997            : AGGAGTCAGAATCAGAGTCTGAGTATGAAGAGTACACAGACAGTGAAGATGAGATGGAGCCTCGCCTTAAGCCAGTCTTCATTCg
rcsk15_i2.y1        : --GAGGCAGAATCAGAGTCTGAGTATGAAGAGTACACAGACAGTGAAGATGAGATGGAGCCTCGCCTTAAGCCAGTCTTCATTCg
rdbla0116_j13.y1    : --gGGTCAGAATCAGAGTCTGAGTATGAAGAGTACACAGACAGTGAAGATGAGATGGAGCCTCGCCTTAAGCCAGTCTTCATTCg
CX065344            : ------------CCCACGCGTCCGCAGAGTCTGAGTATGAAGAGTACACAGACAGTGAAGATGAGATGGAGCCTCGCCTTAAGCc

Cited by

ENST00000267812