Sequences

BGISUSX0000042410

Source Seq Type : all

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>BGISUSX0000042410
AGGAAGGACCGAGTAACAGTTCAAGAACGGGAGGCCGAAGCATTGAAACAGAAGGAGCTGGAGCAGGAGGCCAAACGCATGGCTGAGGAGAGACGCAAAT
ATACACTCAAG

Assemble


--------------------------------------------------------------------------------------------------------------------------
BGISUSX0000042410   : AGGAAGGACCGAGTAACAGTTCAAGAACGGGAGGCCGAAGCATTGAAACAGAAGGAGCTGGAGCAGGAGGCCAAACGCATGGCTGAGGAGAGACGCAAAT
CF363535            : gATTGGCTCGACATCGGAAAATAGTGGAACCCGAAGTGGTGGGAGAAAGTGACTCATAAGTAGAAGGAGATGCTTGGCGCATGGAACGAGAAGATACCAG
rcbr0_011016.y1     : aAGAAGGACCGAGTAACAGTTCAAGAACGGGAGGCCGAAGCATTGCAACAGACGGAGCTGGAGCAGGAGGCCAAACGCATGGCTGAGGAGAGACGCAAAT
rcbl0_019808.y1     : AGGAAGGACCGAGTAACAGTTCAAGAACGGGAGGCCGAAGCATTGAAACAGAAGGAGCTGGAGCAGGAGGCCAAACGCATGGCTGAGGAGAGACGCAAAT
rnlu1836b_b10.y1    : --------------------------------------------------------------GCAGGAGGCCAAACGCATGGCTGAGGAGAGACGCAAAT

---------------------------------
BGISUSX0000042410   : ATACACTCAAG
CF363535            : TGAAGAAGAAg
rcbr0_011016.y1     : ATACACTCAa@
rcbl0_019808.y1     : ATACACTCAAg
rnlu1836b_b10.y1    : ATACACTCAAg

Cited by

ENST00000267812