Sequences

BGISUSX0000042419

Source Seq Type : all

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>BGISUSX0000042419
ATTGTAGAAGAAGAGACCAAGAAAGAGCTGGAGGAGAACAAGCGGTCCCTGGCTGCGCTAGATGCACTCAATACTGATGATGAAAATGATGAGGAGGAAT
ATGAAGCATGGAAAGTTCGGGAGCTAAAGAGAATCAAGAGGGACAGAGAAGATAGAGAA

Assemble


--------------------------------------------------------------------------------------------------------------------------
BGISUSX0000042419   : ATTGTAGAAGAAGAGACCAA*GAAAGAGCTGGAGGAGAACAAGCGGTCCCTGGCTGCGCTAGATGCACTCAATACTGATGATGAAAATGATGAGGAGGAA
rcsk15_i2.y1        : ATTGTAGAAGAAGAGACCGGgGAAAGAGCTGGAGGAGAACAAGCGGTCCCTGGCTGCGCTAGATGCACTCAATACTGATGATGAAAATGATGAGGAGGAA
rcbl0_010369.y1     : ATTGTAGAAGAAGAGACCAA*GAAAGAGCTGGAGGAGAACAAGCGGTCCCTGGCTGCGCTAGATGCACTCAATACTGATGATGAAAATGATGAGGAGGAA
rcbl0_019808.y1     : ATTGTAGAAGAAGAGACCAA*GAAAGAGCTGGAGGAGAACAAGCGGTCCCTGGCTGCGCTAGATGCACTCAATACTGATGATGAAAATGATGAGGAGGAA
rcbr0_011347.y1     : ATTGTAGAAGAAGAGACCAA*GAAAGAGCTGGAGGAGAACAAGCGGTCCCTGGCTGCGCTAGATGCACTCAATACTGATGA@------------------
CX065344            : CCCACGCGTCCGCAGAGTCT*GAGTATGAAGAGTACACAGACAGTGAAGATGAGATGGAGCCTCGCCTTAAGCCAGTCTTCATTCGGAAGAAGGACCGAG
rcbr0_004955.y1     : ATTGTAGAAGAAGAGACCAA*GAAAGAGCTGGAGGAGAACAAGCGGTCCCTGGCTGCGCTAGATGCACTCAATACTGATGATGAAAATGATGAGGAGGAA
AJ656997            : GATGGAAGTCATGGAGGTGG*AAGATGAGGGGCGTTCTGGGGAGGAGTCAGAATCAGAGTCTGAGTATGAAGAGTACACAGACAGTGAAGATGAGATGGA
CF363535            : GATTGGCTCGACATCGGAAA*ATAGTGGAACCCGAAGTGGTGGGAGAAAGTGACTCATAAGTAGAAGGAGATGCTTGGCGCATGGAACGAGAAGATACCA
rcbr0_016178.y1     : atGGTAGAAGAAGAGACCAA*GAAAGAGCTGGAGGAGAACAAGCGGTCCCTGGCTGCGCTAGATGCACTCAATACTGATGATGAAAATGATGAGGAGGAC
rste08_h11.y1       : ----------------------------------------------------------------------------------------gGTGAGGAGGAA

----------------------------------------------------------------------------------
BGISUSX0000042419   : TATGAAGCATGGAAAGTTCGGGAGCTAAAGAGAATCAAGAGGGACAGAGAAGATAGAGAA
rcsk15_i2.y1        : TATGAAGCATGGAAAGTTCGGGAGCTAAAGAGAATCAAGAGGGACAGAGAAGATAGacaa
rcbl0_010369.y1     : TATGAAGCATGGAAAGTTCGGGAGCTAAAGAGAATCACGAGGGACAGAGAAGATAGAGAA
rcbl0_019808.y1     : TATGAAGCATGGCAAGTTCGGGAGCTAAAGAGAATCAAGAGGGACAGAGAAGATAGAGAA
rcbr0_011347.y1     : ------------------------------------------------------------
CX065344            : TAACAGTTCAAGAACGGGAGGCCGAAGCATTGAAACAGAAGGAGCTGGAGCAGGAGGCCA
rcbr0_004955.y1     : TATGAAGCATGGAAAGTTCGGGAGCTAAAGAGAATCAAGAGGGACCGAGAAGA@------
AJ656997            : GCCTCGCCTTAAGCCAGTCTTCATTCGGAAGAAGGACCGAgtaacagttcaagaacggga
CF363535            : GTGAAGAAGAAGAAGAAGAGATTGATGATGAGGAAATagagcgacgccgtggcatgatgc
rcbr0_016178.y1     : TATGAAGCATGGAAA@--------------------------------------------
rste08_h11.y1       : TATGAAGCATGGAAAGTTCGGGAGCTAAAGAGAATCAAGAGGGACAGAGAAGATAGAGAa

Cited by

ENST00000267812