Sequences

BGISUSX0000054987

Source Seq Type : all

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>BGISUSX0000054987
ATTCAGAAGTTTATCAGTGAGGACCGCCTTCCGCACCTCCTTCTCTATGGTCCTCCAGGCACGGGAAAGACATCCACCATCCTGGCCTGTGCTAAACAGC
TGTACAAAGATAAGGAATTCGGCTCCATGGTCTTGGAG

Assemble


--------------------------------------------------------------------------------------------------------------------------
BGISUSX0000054987   : ATTCAGAAGTTTATCAGTGAGGACCGCCTTCCGCACCTCCTTCTCTATGGTCCTCCAGGCACGGGAAAGACATCCACCATCCTGGCCTGTGCTAAACAGC
BP141593            : ACTTTTGCGCGCGAACTCTAAGCTCTAGGGTCGCGGGGCCAGGTTCGCGGTTGCTCGCGGGGCAGGCCCCTGAGGGACGAGACGGCGTCACTGGACCTGG
rmcp20c_k16.y1      : ATTCAGAAGTTTATCAGTGAGAACCGCCTTCCGCACCTCCTTCTCTATGGTCCTCCAGGCACGGGAAAGACATCCACCATCCTGGCCTGTGCTAAACAGC
rdpbxa0_085104.y1   : -TTCAGAAGTTTATCAGTGAGGACCGCCTTCCGCACCTCCTTCTCTATGGTCCTCCAGGCACGGGAAAGACATCCACCATCCTGGCCTGTGCTAAACAGC
dpcxa0_045173.z1    : -TTCAGAAGTTTATCAGTGAGGACCGCCTTCCGCACCTCCTTCTCTATGGTCCTCCAGGCACGGGAAAGACATCCACCATCCTGGCCTGTGCTAAACAGC
rski0110_j6.y1      : -----------------------------------------------------------------------------CATCCTGGCCTGTGCTAAACAGC

------------------------------------------------------------
BGISUSX0000054987   : TGTACAAAGATAAGGAATTCGGCTCCATGGTCTTGGAG
BP141593            : ACACCTTCATCACCCCATCATGCAGACCTCAGCGCACa
rmcp20c_k16.y1      : TGTACAAAGATAAGGAATTCGGCTCCATGGTCTTGGa@
rdpbxa0_085104.y1   : TGTACAAAGATAAGGAATTCGGCTCCATGGTCTTGGAg
dpcxa0_045173.z1    : t@@-----------------------------------
rski0110_j6.y1      : TGTACAAAGATAAGGAATTCGGCTCCATGGTCTTGGAg

Cited by

ENST00000229043