Sequences

BGISUSX0000055009

Source Seq Type : all

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>BGISUSX0000055009
GTGATTGAAAAATTTACTGAAAATACCAGATTTTGCCTCATCTGCAACTATCTGTCAAAGATCATTCCCGCCTTGCAGTCCCGGTGTACAAGGTTCCGAT
TCGGCCCCCTGACTCCTGAACTCATGGTTCCCCGCCTGGAACATGTTGTAGAAGAAGAG

Assemble


--------------------------------------------------------------------------------------------------------------------------
BGISUSX0000055009   : GTGATTGAAAAATTTACTGAAAATACCAGATTTTGCCTCATCTGCAACTATCTGTCAAAGATCATTCCCGCCTTGCAGTCCCGGTGTACAAGGTTCCGAT
BP459307            : ACTTACTTTTGCGCGCGAACTCTAAGCTCTAGGGTCCCGGGGCCAGGTTCGCGGTTGCTCGCGGGGCAGGCCCCTGAGGGACGAGACGGCGTCACTGGAC
BP141593            : ACTTTTGCGCGCGAACTCTAAGCTCTAGGGTCGCGGGGCCAGGTTCGCGGTTGCTCGCGGGGCAGGCCCCTGAGGGACGAGACGGCGTCACTGGACCTGG

---------------------------------------------------------------------------------
BGISUSX0000055009   : TCGGCCCCCTGACTCCTGAACTCATGGTTCCCCGCCTGGAACATGTTGTAGAAGAAGAG
BP459307            : CTGGACACCTTCATCACCCCATCATGCAGACCTCAGCGCACAAGCAGcagcagcagccc
BP141593            : ACACCTTCATCACCCCATCATGCAGACCTCAGCGCACAAGCAGCAGCAGCAGCCCGAGg

Cited by

ENST00000229043