Sequences

BGISUSX0000055027

Source Seq Type : all

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>BGISUSX0000055027
AATATTATGGAGTTGAAAACTCTGAAGGGACTGGCATTAAATGACATCCTGACGGAGATACACTTGTTTGTGCACAGA

Assemble


----------------------------------------------------------------------------------------------------
BGISUSX0000055027   : AATATTATGGAGTTGAAAACTCTGAAGGGACTGGCATTAAATGACATCCTGACGGAGATACACTTGTTTGTGCACAGA
rsag035_d2.y1       : AATATTATGGAGTTGAAAACTCTGAAGGGACTGGCATTAAATGACATCCTGACGGAGATACACTTGTTTGTGCACAGA

Cited by

ENST00000229043