Sequences

BGISUSX0000126091

Source Seq Type : all

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>BGISUSX0000126091
GTCTGGAAAAATGATCACATAAAAGACAGGAGCCAAGAAAACCAGTCTAAACATGTGTGGGAAGTTGTATTCATCAGTAACAAAATGCTAACTGAAGAAC
AAGGTAACGTAATAGGAAAACCATTGAATTTGGACACAGATTCATTTCCTAACAGAAAAATACTCTGTCAGTGTGACTCATGTGAAATGAGCTTCAACTG
TCTTTCAGAATTTGTTATCAATAAGAAAAACTATTTGGG

Assemble


--------------------------------------------------------------------------------------------------------------------------
BGISUSX0000126091   : GTCTGGAAAAATGATCACATAAAAGACAGGAGCCAAGAAAACCAGTCTAAACATGTGTGGGAAGTTGTATTCATCAGTAACAAAATGCTAACTGAAGAAC
dpcxb0_101808.z1    : GTCTGGAAAAATGATCACATAAAAGACAGGAGCCAAGAAAACCAGTCTAAACATGTGTGGGAAGTTGTATTCATCAGTAACAAAATGCTAACTGAAGAAC

--------------------------------------------------------------------------------------------------------------------------
BGISUSX0000126091   : AAGGTAACGTAATAGGAAAACCATTGAATTTGGACACAGATTCATTTCCTAACAGAAAAATACTCTGTCAGTGTGACTCATGTGAAATGAGCTTCAACTG
dpcxb0_101808.z1    : AAGGTAACGTAATAGGAAAACCATTGAATTTGGACACAGATTCATTTCCTAACAGAAAAATACTCTGTCAGTGTGACTCATGTGAAATGAGCTTCAACTG

-------------------------------------------------------------
BGISUSX0000126091   : TCTTTCAGAATTTGTTATCAATAAGAAAAACTATTTGGG
dpcxb0_101808.z1    : TCTTTCAGAATTTGTTATCAATAAGAAAAACTATTTGGG

Cited by

ENST00000307441