Sequences

BGISUSX0000133328

Source Seq Type : all

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>BGISUSX0000133328
TTCTGGAAGCCTCGGAACCTCAACATCACCCAACATGGCTCAGACATGCAGGTGTCCTTCGACCACGCGCCACATACCTTCGGCTTCCGTTTCTTTTATC
TTCACTACAAGCTCAAGCACGAAGGACTCTTCAAACGAAAGACCTGCAAACAG

Assemble


--------------------------------------------------------------------------------------------------------------------------
BGISUSX0000133328   : TTCTGGAAGCCTCGGAACC*TCAACATCACCCAACATGGCTCAGACATGCAGGTGTCCTTCGACCACGCGCCACATACCTTCGGCTTCCGTTTCTTTTAT
BW965550            : GCGCCGGGCCGGGCTGGGCcAGC*GCACGGCCATGGCCCCGTGGTTGCAGCTCTGctctgtcttcttcaccgtcaacgcctgcctcaacggctcgcaatt
BP154750            : AGAGTAGCGCCGGGCCGGG*CTGAGCGAGCGCACGGCCATGGCCCCGTGGTTGCAGCTCTGTTCTGTCTTCTTCACCGTCAACGCCTGCCTCAAcggctc
CJ025168            : GGGCACGGCCATGGCCCCG*TGGATGCAGCTCTGCTCTGTCTTCTTCACCGTCAACGCCTGCCTCAACGGCTCGCAATTGGCCGTGGCCGCAGGTGGCTC
CT127045            : -ATGCCATAGCAGCAACCT*GAGATGCTACAGTGACAATGCTGGATCCTTAACCAGCTGCACCACAAGAGAACACCGAATTGATGCATTTTTCATTCTTC

----------------------------------------------------------------------------
BGISUSX0000133328   : CTTCACTACAAGCTCAAGCACGAAGGACTCTTCAAACGAAAGACCTGCAAACAG
BW965550            : ggccgtggccgcaggtggctccagcagagctcggggcggcgacacctgcggctg
BP154750            : gcaattggccgtggccgcaggtggctccagcagagctcggggcggcgacacctg
CJ025168            : CAGCAGAGCTCGGGGCGGCGACACCTGCGGCTGGAGGGGAGTGGGGCCGGCCAG
CT127045            : CCAGCAGCACCCAGTGCTGTTTATTTATACTGTATTGAATTGTTGCAGGAGAAA

Cited by

ENST00000320057