Sequences

BGISUSX0000133340

Source Seq Type : all

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>BGISUSX0000133340
TATTTCGATTATTCCTGCGAGGGAGACGTTCCCGGTGTCTTGGACCTGAGTACCAAGTACAAACTCATGGACAACCTTCCGCAGCTCTGCTCCCACCTAC
ACTCTCAGGGCCGCAGACCCCAGGAGCCGGGGCCGCTTCCGGGCCGCGTCAGCAGGAGGAACTACTTCCGGAGCAAATCGGGCCGCTCCCTGTATGTGGC
CATTTGCAACATGCACCAGTTTATAGACGAGGAGCCCGACTGGTTTGAGAAGCAGTTCGTCCCCTTCCATCCTACCCCACTACGCCACCGGGAGCCAGTC
CTGGAGAAGTTTGACTCGGGCTTGGTTTTGAACGACGTCACTGGCAGGCCAGGGCCCGAGAGCGACTTCGGGCTCAAGGCTGAGGCCACAGGCCCCGGGG
C

Assemble


--------------------------------------------------------------------------------------------------------------------------
BGISUSX0000133340   : TATTTCGATTATTCCTGCGAGGGAGACGTTCCCGGTGTCTTGGACCTGAGTACCAAGTACAAACTCATGGACAACCTTCCGCAGCTCTGCTCCCACCTAC
BP449722            : TATTTCGATTATTCCTGCGAGGGAGACGTTCCCGGTGTCTTGGACCTGAGTACCAAGTACAAACTCATGGACAACCTTCCGCAGCTCTGCTCCCACCTAC

--------------------------------------------------------------------------------------------------------------------------
BGISUSX0000133340   : ACTCTCAGGGCCGCAGACCCCAGGAGCCGGGGCCGCTTCCGGGCCGCGTCAGCAGGAGGAACTACTTCCGGAGCAAATCGGGCCGCTCCCTGTATGTGGC
BP449722            : ACTCTCAGGGCCGCAGACCCCAGGAGCCGGGGCCGCTTCCGGGCCGCGTCAGCAGGAGGAACTACTTCCGGAGCAAATCGGGCCGCTCCCTGTATGTGGC

--------------------------------------------------------------------------------------------------------------------------
BGISUSX0000133340   : CATTTGCAACATGCACCAGTTTATAGACGAGGAGCCCGACTGGTTTGAGAAGCAGTTCGTCCCCTTCCATCCTACCCCACTACGCCACCGGGAGCCAGTC
BP449722            : CATTTGCAACATGCACCAGTTTATAGACGAGGAGCCCGACTGGTTTGAGAAGCAGTTCGTCCCCTTCCATCCTACCCCACTACGCCACCGGGAGCCAGTC

--------------------------------------------------------------------------------------------------------------------------
BGISUSX0000133340   : CTGGAGAAGTTTGACTCGGGCTTGGTTTTGAACGACGTCACTGGCAGGCCAGGGCCCGAGAGCGACTTCGGGCTCAAGGCTGAGGCCACAGGCCCCGGGG
BP449722            : CTGGAGAAGTTTGACTCGGGCTTGGTTTTGAACGACGTCACTGGCAGGCCAGGGCCCGAGAGCGACTTCGGGCTCAAGGCTGAGGCCACAGGCCCCGGGG

-----------------------
BGISUSX0000133340   : C
BP449722            : C

Cited by

ENST00000320057