Sequences

BGISUSX0000141490

Source Seq Type : all

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>BGISUSX0000141490
GGCCACCTGCAGCCACACTTGGAACCACCGAGTCTCGTTCAGGACCTCCCAGCAGGTGTAGTTCCCCTCATCCTGCAGGCTCAGTGCCTCAATGTGCAGG
GAGCTGGCATTCACCAGACAGAAGCGTGGCTGGGCTGACGGCAGACTGGAATTGGAGGACACGAGGAAGACAGGCTCCGAGTCATTCCGATACCAGGTCA
CGAGGCCCCTCGGTCCTGAGATGTTGCCACAGAGCAGCGTGACATTCTCTTGAACTTCTCCGATGACAGCAGCCTCCAGTCC

Assemble


--------------------------------------------------------------------------------------------------------------------------
BGISUSX0000141490   : GGCCACCTGCAGCCACACTTGGAACCACCGAGTCTCGTTCAGGACCTCCCAGCAGGTGTAGTTCCCCTCATCCTGCAGGCTCAGTGCCTCAATGTGCAGG
CT272164            : TTTGTTGCATGATAAACTGAGGTTAACAGCAAGGATAACATTAACAAGCTAAAAGTAATAGCCAACTAATATTGCCAGTGGCCACTCTACAGCACTTTAT
rdpcxb0_290483.y1   : GGCCACCTGCAGCCACACTTGGAACCACCGAGTCTCGTTCAGGACCTCCCAGCAGGTGTAGTTCCCCTCATCCTGCAGGCTCAGTGCCTCAATGTGCAGG

--------------------------------------------------------------------------------------------------------------------------
BGISUSX0000141490   : GAGCTGGCATTCACCAGACAGAAGCGTGGCTGGGCTGACGGCAGA*CTGGAATTGGAGGACACGAGGAAGACAGGCTCCGAGTCATTCCGATACCAGGTC
CT272164            : ATAGATAAACTGGCATCTATTCCTCACAGCAATTCTTACAAGGCAaGAATTCCTttcatccccattttacagatgacaaaataacaggtgtaagaagtca
rdpcxb0_290483.y1   : GAGCTGGCATTCACCAGACAGAAGCGTGGCTGGGCTGACGGCAGA*CTGGAATTGGAGGACACGAGGAAGACAGGCTCCGAGTCATTCCGATACCAGGTC

---------------------------------------------------------------------------------------------------------
BGISUSX0000141490   : ACGAGGCCCCTCGGTCCTGAGATGTTGCCACAGAGCAGCGTGACATTCTCTTGAACTTCTCCGATGACAGCAGCCTCCAGTCC
CT272164            : ctcagcctacaggcagcagagcccagcatgaaatccaggctgccaactccaaagctctcctcaggttcaaggctctgagtgtc
rdpcxb0_290483.y1   : ACGAGGCCCCTCGGTCCTGAGATGTTGCCACAGAGCAGCGTGACATTCTCTTGAACTTCTCCGATGACAGCAGCCTCCAGTCC

Cited by

ENST00000332034