Sequences

BGISUSX0000151624

Source Seq Type : all

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>BGISUSX0000151624
ATGACAGACCGCTACACCATCCACAGCCAGTTAGAGCACCTGCAGTCCAAATACATCGGCACCGGCCACGCCGACACCACCAAATGGGAGTGGCTGGTGA
ACCAGCACCGCGACTCCTATTGCTCCTACATGGGCCACTTCGACCTTCTCAACTACTTTGCCATTGCCGAGAATGAGAGCAAAGCGCGAGTCCGCTTCAA
CTTGATGGAGAAGATGCTGCAGCCTTGCGGCCCGCCCGCCGACAAACCGGAGGAGAACTGA

Assemble


--------------------------------------------------------------------------------------------------------------------------
BGISUSX0000151624   : ATGACAGACC*GCTACACCATCCACAGCCA*G*TTAGAGCACCTGCAG*TCCAAATACATC*GG*C*ACCGGCCACGCCGACACCACCAA*A*TGGGAGT
rcje16_a6.y1        : ATGACAGACC*GCTACACCATCCACAGCCA*GgTTAGAGCATCTGCAG*TCCAAATACATC*GGtC*ACCGGCCACGCCGAGGCCACCAA*A*TGGGAGT
rcsp18b_c14.y1      : ATGACAGACC*GCTACACCATCCACAGCCA*G*TTAGAGCATCTGCAG*TCCAAATACATC*GG*C*ACCGGCCACGCCGACACCACCAA*A*TGGGAGT
rton1222b_l5.y1     : ATGACAGACCTGCTACACCATCCACAGCCA*G*TTAGAGCATCTGCAG*TCCAAATACATCtGG*C*ACCGGCCACGCCGACACCACCAA*A*TGGGAGT
rcut28_j15.y1       : ATGACAGACC*GCTACACCATCCACAGCCA*G*TTAGAGCATCTGCAG*TCCAAATACATC*GG*C*ACCGGCCACGCCGACACCACCAA*A*TGGGAGT
rcje13_j17.y1       : ATGACAGACC*GCTACACCATCCACAGCCA*G*TTAGAGCATCTGCAGcTCCAAATACATC*GG*C*ACCGGCCACGCCGACACCACCAA*A*TGGGAGT
rcut18_j21.y1       : ATGACAGACC*GCTACACCATCCACAGACAtG*TTAGAGCATCTGCAG*TCCAAATACATC*GG*C*ACCGGCCACGCCGACACCACCAA*A*TGGGAGT
rste03_h14.y1       : ATGACAGACC*GCTACACCATCCACAGCCA*G*TTAGAGCATCTGCAG*TCCAAATACATC*GG*C*ACCGGCCACGCCGACACCACCAA*A*TGGGAGT
CK463251            : GCGGGTGGCT*CCTCTCCGGCGTGAAACCT*T*AGAGCGGCTTCTTGT*CGTCTGCGGGTT*CT*G*ACCTGCGAGCAAAGGAAAAAGCA*A*CGAGATG
reep32c_o23.y1      : ATGACAGACC*GCTACACCATCCACAGCCA*G*TTAGAGCATCTGCAG*TCCAAATACATC*GG*C*ACCGGCCACGCCGACACCACCAA*A*TGGGAGT
rplac_3838.y1       : ATGACAGACC*GCTACACCATCCACAGCCA*G*TTAGAGCATCTGCAG*TCCAAATACATC*GT*C*ACCGGCCACGCCTACACCACCTA*a*TGGGAGT
rcje14_l18.y1       : ATGACAGACC*GCTACACCATCCACAGCCA*G*TTAGAGCATCTGCAG*TCCAAATACATC*GG*C*ACCGGCCACGCCGACACCACCAA*A*TGGGAGT
rcki09_i7.y1        : ATGACAGAGC*GCTACACCATCCACAGCCA*G*TTAGAGCACCTGCAG*TCCAAATACATC*GG*C*ACCGGCCACGCCGACAGCACCAA*A*TGGGAGT
rcki24_e15.y1       : ATGACAGACC*GCTACACCATCCACAGCCA*G*TTAGAGCACCTGCAG*TCCAAATACATC*GG*C*ACCGGCCACGCCGACACCACCAA*A*TGGGAGT
rcki012_k11.y1      : ATGACAGACC*GCTACACCATCCACAGCCA*G*TTAGAGCACCTGCAG*TCCAAATACATC*GG*C*ACCGGCCACGCCGACACCACCAA*A*TGGGAGT
rcst34_b14.y1       : ATGACAGACC*GCTACACCATCCACAGCCA*G*TTAGAGCACCTGCAG*TCCAAATACATC*GG*C*ACCGGCCACGCCGACACCACCAA*A*TGGGAGT
BX667191            : TCTGACCTGC*GAGCAAAGGAAAAAGCAAC*G*AGATGACAGACCGTT*ACACCATCCACA*GC*C*AGTTAGAGCATCTGCAGTCCAAA*A*ACATGGG
rjca21c_i16.y1      : ATGACAGACC*GCTACACCATCCACAGCCA*G*TTAGAGCATCTGCAG*TCCAAATACATC*GG*C*ACCGGCCACGCCGACACCACCAA*A*GGGGAGT
rpldo0104_d14.y1    : ATGACAGACC*GCTACACCATCCACAGCCA*G*TTAGAGCATCTGCAG*TCCAAATACATC*GG*C*ACCGGCCACGCCGACACCACCAA*A*TGGGAGT
DV904096            : CGGGCGGGTG*GCTCCTCTCCGGCTGGGGA*C*CTTAGAGCGGCTTCT*TCTCGTCTGGGG*CT*T*CTGACCTGGGAGCAAAGGAAAAA*A*CAACGAG
rplac_3456.y1       : ATGACAGACC*GCTACACCATCCACAGCCA*G*TTAGAGCATCTGCAG*TCCAAATACATC*GG*C*ACCGGCCACGCCGACACCACCAA*A*TGGGAGT
rplac_12247.y1      : ATGACAGACC*GCTACACCATCCACAGCCA*G*TTAGAGCATCTGCAG*TCCAAATACATC*GG*C*ACCGGCCACGCCGACACCACCAA*A*TGGGAGT
BF704213            : GCGAGCAAAG*GAAAAAGCAACGAGATGAC*A*GACCGNTACACCATC*CACAGCCAGTTA*GA*G*CATCTGCAGTCCAAATACATCGG*A*ACCGGCC
rthg34_b20.y1       : -TGACAGACC*GCTACACCATCCACAGCCA*G*TTAGAGCATCTGCAG*TCCAAATACATC*GG*CgACCGGCCACGCCGACACCACCAA*A*TGGGAGT
rhea14_a17.y1       : ATGACAGACC*GCTACACCATCCACAGCCA*G*TTAGAGCATCTGCAG*TCCAAATACATC*GG*C*ACCGGCCACGCCGACACCACCAA*A*TGGGAGT
rcga35b_f13.y1      : ATGACAGACC*GCTACACCATCCACAGCCA*G*TTAGAGCATCTGCAG*TCCAAATACATC*GG*C*ACCGGCCACGCCGACACCACCAA*A*TGGGAGT
CF790452            : CGCGTGTACA*GAGGTTCCGGCGGGTGGCT*C*CTCTCCGGCTTGAAA*CCTTAGAGCGGC*TT*C*TTCTCGTCTGCGGCTTCTGACCT*A*CGAGCAA
rcly12b_p24.y1      : ATGACAGACC*GCTACACCATCCACAGCCA*G*TTAGAGCATCTGCAG*TCCAAATACATC*GG*C*ACCGGCCACGCCGACACCACCAA*A*TGGGAGT
rcut16_a21.y1       : ATGACAGACC*GCTACACCATCCACAGCCA*G*TTAGAGCATCTGCAG*TCCAAATACATC*GG*C*ACCGGCCACGCCGACACCACCAA*A*TGGGAGT
rcut26_p21.y1       : ATGACAGACC*GCTACACCATCCACAGCCA*G*TTAGAGCATCTGCAG*TCCAAATACATC*GG*C*ACCGGCCACGCCGACACCACCAA*A*TGGGAGT
rese08c_m23.y1      : ATGACAGACC*GCTACACCATCCACAGCCA*G*TTAGAGCATCTGCAG*TCCAAATACATC*GG*C*ACCGGCCACGCCGACACCACCAA*A*TGGGAGT
DN105563            : GATGACAGAC*CGCTACACCATCCACAGCC*A*GTTAGAGCATCTGCA*GTCCAAATACAT*CG*G*CACCGGCCACGCCGACACCACCA*A*ATGGGAG
rcut39_n24.y1       : ATGACAGACC*GCTACACCATCCACAGCCA*G*TTAGAGCATCTGCAG*TCCAAATACATC*GG*C*ACCGGCCACGCCGACACCACCAA*A*TGGGAGT
rcad27b_i16.y1      : ATGACAGACC*GCTACACCATCCACAGCCA*G*TTAGAGCATCTGCAG*TCCAAATACATC*GG*C*ACCGGCCACGCCGACACCACCAA*A*TGGGAGT
CB478450            : CAGAGGTTCC*GGCGGGTGGCTCCTCTCCG*G*CTTGAAACCTTAGAG*CGGCTTCTTCTC*GT*C*TGCGGCTTCTGACCTGCGAGCAA*A*GGAAAAA
rcje20_m11.y1       : ATGACAGACC*GCTACACCATCCACAGCCA*G*TTAGAGCATCTGCAG*TCCAAATACATC*GG*C*ACCGGCCACGCCGACACCACCAA*A*TGGGAGT
rcje15_p23.y1       : ATGACAGACC*GCTACACCATCCACAGCCA*G*TTAGAGCATCTGCAG*TCCAAATACATC*GG*C*ACCGGCCACGCCGACACCACCAA*A*TGGGAGT
BI360171            : --GCGGCTTC*TTCTCGTCTGCGGCTTCTG*A*CCTGCGAGCAAAGGA*AAAAGAACGAGG*AG*A*CAGACCGCTACACCATCCACAGC*A*AGTTAGA
BI360170            : --GCGGCTTC*TTCTCGTCTGCGGCTTCTG*A*CGCTGCGAGCAAGGG*AAAAAGCAACGA*GA*A*GACAGACCGCTACACCATCCACA*A*CCAGTTA
BI347000            : ---ACAGACC*GCTACACCATCCACAGCCA*G*TTAGAGCATCTGCAG*TCCAAATACATC*GG*C*ACCGGCCACGCCGACACCACCAA***TGGGAGT
rche18_p5.y1        : ------GACC*GCTACACCATCCACAGCCA*G*TTAGAGCATCTGCAG*TCCAAATACATC*GG*C*ACCGGCCACGCCGACACCACCAA*A*TGGGAGT
rcsk15_k17.y1       : --------------ACACCATCCACAGCCA*G*TTAGAGCACCTGCAG*TCCAAATACATC*GG*C*ACCGGCCACGCCGACACCACCAA*A*TGGGAGT
CK462928            : ---------------CACCATCCACAGCCA*G*TTAGAGCATGTCCAG*TCCAAATACATC*GG*C*ACCGGCCACGCGGACACCACCAA*A*TGGGAGT
rcje31_f23.y1       : --------------------------GCCA*G*TTAGAGCATCTGCAG*TCCAAATACATC*GG*C*ACCGGCCACGCCGACACCACCAAgagTGGGAGT
rsme33_n17.y1       : -------------------------agGCA*G*TTAGAGCATCTGCAG*TCCAAATACATC*GG*C*ACCGGCCACGCCGACACCACCAA*A*TGGGAGT
rfcc36b_m21.y1      : ----------------------------------tggatcccccgggc*tgcaggaattct*gg*c*acgaggcacGCCGACACCACCAA*A*TGGGAGT
rcki014_g14.y1      : ------------------------------------GAGCACCTGCAG*TCCAAATACATC*GG*C*ACCGGCCACGCCGACACCACCAA*A*TGGGAGT
rcki05_g17.y1       : ---------------------------------------CACCTGCAG*TCCAAATACATC*GG*C*ACCGGCCACGCCGACACCACCAA*A*TGGGAGT
rcki30_k24.y1       : ------------------------------------------CTGCAG*TCCAAATACATC*GG*C*ACCGGCCACGCCGACACCACCAA*A*TGGGAGT
CF789762            : ---------------------------------------------CAG*TCCAAATACATC*GG*C*ACCGGCCACGCCGACACCACCAA*A*TGGGAGT
DY411911            : ---------------------------------------------------CAAATACATC*GG*C*ACCGGCCACGCCGACACCACCAA*A*TGGGAGT
DW337902            : ---------------------------------------------------------ggaa*tT*C*GGCACCAGCACCGGCCACGCCGA*A*ACCACCA
rcje04_g18.y1       : -----------------------------------------------------------------t*cggcacgagGCCGACACCACCAA*A*TGGGAGT
rcut08_k8.y1        : ---------------------------------------------------------------------------------------CAA*A*TGGGAGT
DV898029            : ----------------------------------------------------------------------------------------AA*a*TGGGACT
rjej21b_l24.y1      : ----------------------------------------------------------------------------------------------------
rcut34_d9.y1        : ----------------------------------------------------------------------------------------------------
rcte05_m14.y1       : ----------------------------------------------------------------------------------------------------
rcki020_k22.y1      : ----------------------------------------------------------------------------------------------------
CA778851            : ----------------------------------------------------------------------------------------------------
rcje02_l13.y1       : ----------------------------------------------------------------------------------------------------
rcut37_n9.y1        : ----------------------------------------------------------------------------------------------------
rcut28_a14.y1       : ----------------------------------------------------------------------------------------------------
rfhi4011b_l19.y1    : ----------------------------------------------------------------------------------------------------
rcbe15_j6.y1        : ----------------------------------------------------------------------------------------------------
rcly26b_b2.y1       : ----------------------------------------------------------------------------------------------------
rsto218_j11.y1      : ----------------------------------------------------------------------------------------------------
rcmu31_e5.y1        : ----------------------------------------------------------------------------------------------------
BI404390            : ----------------------------------------------------------------------------------------------------
BF703206            : ----------------------------------------------------------------------------------------------------
rcsk21_o2.y1        : ----------------------------------------------------------------------------------------------------
rmcp28c_m15.y1      : ----------------------------------------------------------------------------------------------------
rcst16_a15.y1       : ----------------------------------------------------------------------------------------------------
rcsp10b_p23.y1      : ----------------------------------------------------------------------------------------------------
rhyp08c_f15.y1      : ----------------------------------------------------------------------------------------------------

--------------------------------------------------------------------------------------------------------------------------
BGISUSX0000151624   : GG*CTGGTGAACCAGCACCGCGACTCC*T*ATTGCTCCTACATGG*GCCACTTC*GACCTTCTCAACTACTTTGCCATTG*CCGAGAATGAGA*GCAAAG
rcje16_a6.y1        : GG*CTGGTGAACCAGCACCGCGACTCC*T*ATaGCTCCTACATGG*GCCACTTC*GACCTTCTCAACTACTTGGCCATTG*CCGAGAATGAGA*GCAAAG
rcsp18b_c14.y1      : GG*CTGGTGAACCAGCACCGCGACGCGgT*ATTGCTCCTACATGG*GCCACTTC*GACCTTCTCAACTACTTGGCCATTG*CCGAGAATGAGA*GCAAAG
rton1222b_l5.y1     : GG*CTGGTGAACCAGCACCGCGACTCC*T*ATTGCTCCTACATGG*GCCACTTC*GACCTTCTCAACTACTTCGCCATTG*CCGAGAATGAGAtGCAAAG
rcut28_j15.y1       : GG*CTGGTGAACCAGCACCGCGACTCC*T*ATTGCTCCTACATGG*GCCACTTC*GACCTTCTCAACTACTTCGCCATTG*CCGAGAATGAGA-------
rcje13_j17.y1       : GG*CTGGTGAACCAGCACCGCGACTCC*T*ATTGCTCCTACATGG*GCCACTTC*GACCTTCTCAACTACTTCGCCATTG*CCGAGAATGAGA*GC----
rcut18_j21.y1       : GG*CTGGTGAACCAGCACCGCGACTCC*T*ATTGCTCCTACATGG*GCCACTTC*GACCTTCTCAACTACTTCGCCATTG*CCGAGAATGAGA*GCAAAG
rste03_h14.y1       : GG*CTGGTGAACCAGCACCGCGACTCC*T*ATTGCTCCTACATGG*GCCACTTC*GACCTTCTCAACTACTTTGCCATTG*CCGAGAATGAGA*GCAAAG
CK463251            : AG*AGACCGGTACACCATCCACAGCCA*G*TTTGAGCATCTGCAG*TCCAAATA*CATCGGCACCGGCCACGCCGACACC*ACCAAATGGGAG*TGGCTG
reep32c_o23.y1      : Gg*CGGGTGAACCAGCACCGCGACTCC*T*ATnGCTCCTACATGG*GCCACTTC*GACCTTCTCAACTACTTTGCCATTG*CCGAGAATGAGA*GCAAAG
rplac_3838.y1       : GG*CTGGTGAACCAGCACCGCGACTCC*T*ATTGCTCCTACATGG*GCCACTTC*GACCTTCTCAACTACTTCGCCATTG*CCGAGAATGAGA*GCAGAG
rcje14_l18.y1       : GG*CTGGTGAACCAGCACCGCGACTCC*T*ATTGCTCCTACATGG*GCCACTTC*GACCTTCTCAACTACTTCGCCATTG*CCGAGAATGAGA*GCAAAG
rcki09_i7.y1        : GG*CTGGTGAACCAGCACCGCGACTCC*T*ATTGCTCCTACATGG*GCCACTTC*GAGCTTCTCAACTACTTTGCCATTG*CCGAGAATGAGA*GCAAAG
rcki24_e15.y1       : GG*CTGGTGAACCAGCACCGCGACTCC*T*ATTGCGCCTACATGG*GCCACTTC*GACCTTCTCAACTACTTTGCCATTG*CCGAGAATGAGA*GCAAAG
rcki012_k11.y1      : GG*CTGGTGAACCAGCACCGCGACTCC*T*ATTGCTCCTACATGG*GCCACTTC*GACCTTCTCAACTACTTTGCCATTG*CCGAGAATGAGA*GCAAAG
rcst34_b14.y1       : GG*CTGGTGAACCAGCACCGCGACTCC*T*ATTGCTCCTACGTGG*GCCACTTC*GACCTTCTCAACTACTTTGCCATTG*CCGAGAATGAGA*GCAAAG
BX667191            : CggGGGCAACGCCGACACCACCAAAGG*G*GATTGGGCGGGTGAA*CCAGCACC*GCGACTCCTATTGCTCCTACAGGGG*CCACTTCGACCT*TCTCAA
rjca21c_i16.y1      : GG*CTGGTGAACCAGCACCGCGACTCC*T*ATGGCTCCTACATGG*GCCACTTC*GACCTTCTCAACTACTTCGCCATTG*CCGAGAATGAGA*GCAAAG
rpldo0104_d14.y1    : GG*CT-----------------------------------------------------------------------------------------------
DV904096            : Ag*GACAGACCgctacaccatccacag-c-ca-gttagagcatct-gcagtcca-aatacatcggcaccggccacgccga-caccacca-----------
rplac_3456.y1       : GG*CTGGTGAACCAGCACCGCGACTCC*T*ATTGCTCCTACATGG*GCCACTTC*GACCTTCTCAACTACTTCGCCATAG*CCGAGAATGAGA*GCAAAG
rplac_12247.y1      : GG*CTGGTGAACCAGCACCGCGACTCC*T*ATTGCTCCTACATGG*GCCACTTC*GACCTTCTCAACTACTTCTCCATTG*CCGAGAATGAGA*GCAAAG
BF704213            : AG*GCCGACACCACCAAATGGGAGTGG*C*TGTTGAACCAGCACC*GCGACTCC*TATTGCTCCTACATGGGCCACTTCG*ACCTTCTCAANT*ACTTCG
rthg34_b20.y1       : GG*CTGGTGAACCAGCACCGCGACTCC*T*ATTGCTCCTACATGG*GCCACTTC*GACCTTCTCAACTACTTCGCCATTG*CCGAGAATGAGA*GCAAAG
rhea14_a17.y1       : GG*CTGGTGAACCAGCACCGCGACTCC*T*ATTGCTCCTACATGG*GCCACTTC*GACCTTCTCAACTACTTCGCCATTG*CCGAGAATGAGA*GCAAAG
rcga35b_f13.y1      : GG*CTGGTGAACCAGCACCGCGACTCC*T*ATTGCTCCTACATGG*GCCACTTC*GAGCTTCTCAACTACTTCGCCATTG*CCGAGAATGAGA*GCAAAG
CF790452            : AG*GAAAAAGCAACGAGATGACAGACC*G*CTTCACCATCCACAG*CCAGTTAG*AGCATCTGCAGTCCAAATACATCGG*CACCGGCCACGC*CGACAC
rcly12b_p24.y1      : GG*CTGGTGAACCAGCACCGCGACTCC*T*ATGGCTCCTACATGG*GCCACTTC*GACCTTCTCAACTACTTCGCCATTG*CCGAGAATGAGA*GCAAAG
rcut16_a21.y1       : GG*CTGGTGAACCAGCAGCGCGACTCC*T*ATTGCTCCTACATGG*GCCACTTC*GACCTTCTCAACTACTTCGCCATTG*CCGAGAATGAGA*GCAAAG
rcut26_p21.y1       : GG*CTGGTGAACCAGCACCGCGACTCC*T*ATTGCTCCTACATGG*GCCACTGC*GACCTTCTCAACTACTTCGCCATTG*CCGAGAATGAGA*GCAAAG
rese08c_m23.y1      : GG*CTGGTGAACCAGC