Sequences

BGISUSX0000175687

Source Seq Type : all

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>BGISUSX0000175687
GGACATGGAGGAGTGAATCAGCTTGGGGGGGTTTTTGTGAACGGCCGGCCACTCCCGGATGTAGTCCGCCAAAGGATAGTGGAACTTGCTCATCAAGGTG
TCAGGCCCTGCGACATCTCCAGGCAGCTTCGAGTCAGCCATGGTTGTGTCAGCAAAATTCTTGGC

Assemble


--------------------------------------------------------------------------------------------------------------------------
BGISUSX0000175687   : GGACATGGAGGAGTGAATCAGCTTGGGGGGGTTTTTGTGAACGGCCGGCCACTCCCGGATGTAGTCCGCCAAAGGATAGTGGAACTTGCTCATCAAGGTG
BW971412            : GTGGAAACTTTCCCCCCCTGTCCATTCCATCAAGTTCTGAAAAATCAAAATGGATTTAGAGAAAAATTACCCGACTCCTCGGACCGGCAGGACAGGACAT

---------------------------------------------------------------------------------------
BGISUSX0000175687   : TCAGGCCCTGCGACATCTCCAGGCAGCTTCGAGTCAGCCATGGTTGTGTCAGCAAAATTCTTGGC
BW971412            : GGAGGAGTGAATCAGCTTGGGGGGGTTTTTGTGAACGGCCGGCCACTCCCGGATGTAGTCCGCCA

Cited by

ENST00000354465