Sequences

BGISUSX0000179870

Source Seq Type : all

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>BGISUSX0000179870
GAACCCAGTAATAAACGAGTCAAACCCCTTTCCAGAGTCACATCGCTAGCAAACCTCATCCCGCCCGTAAAGGCCACGCCGTTAAAGCGCTTTAGCCAAA
CTCTGCAG

Assemble


--------------------------------------------------------------------------------------------------------------------------
BGISUSX0000179870   : GAACCCAGTAATAAACGAGTCAAACCCCTTTCCAGAGTCACATCGCTAGCAAACCTCATCCCGCCCGTAAAGGCCACGCCGTTAAAGCGCTTTAGCCAAA
BP434282            : GAGTCTCCGTGTAGCCGCAGCCGCCAGGCACCGTGGAGCTGGGGCCCCCTTTCGCTTGGGAGTTTTGTGGTCGTATCGGGTCAGCGGTGACATCCCAAAG
rcbr0_003509.y1     : GAACCCAGTAATAAACGAGTCAAACCCCTTTCCAGAGTCACATCGCGAGCAAACCTCATCCCGCCCGTAAAGGCCACGCCGTTAAAGCGCTTTAGCCAAA
rcbr0_006576.y1     : GAACCCAGTAATAAACGAGTCAAACCCCTTTCCAGAGTCACATCGCTGGCAAACCTCATCCCGCCCGTAAAGGCCACGCCGTTAAAGCGCTTTAGCCAAA
BP460652            : CAGTCTCCGTGTAGCCGCAGCCGCCAGGCACCGTGGAGCTGGGGCCCCCTTTCGCTTGGGAGTTTTGTGGTCGTATCGGGTCAGCGGTGACATCCCAAAG
rcbr0_011538.y1     : GAACCCAGTAATAAACGAGTCAAACCCCTTTCCAGAGTCACATCGCTAGCAAAGCTCATCCCGCCCGTAAAGGCCACGCCGTTAAAGCGCTTTAGCCAAA
rcbr0_011509.y1     : GAACCCAGTAATAAACGAGTCAAACCCCTTTCCAGAGTCACATCGCTAGCAAGGCTCATCCCGCCCGTAAAGGCCACGCCGTTAAAGCGCTTTAGCCAAA

------------------------------
BGISUSX0000179870   : CTCTGCAG
BP434282            : GGCAGGCc
rcbr0_003509.y1     : CTCTGCAg
rcbr0_006576.y1     : CTCTGCAg
BP460652            : GGCAGGCc
rcbr0_011538.y1     : CTCTGCAg
rcbr0_011509.y1     : CTCTGCAg

Cited by

ENST00000296315