Sequences

BGISUSX0000179894

Source Seq Type : all

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>BGISUSX0000179894
CTCCCTTGTCTTAGCTCCTATGACAGCTACTGCAGCAATCAAGTAGCTGCCAAGGCTCTGCTGGACCACAAGAAACAAGATCACCGAGTCCAAGACTTCC
TACAGCGATGTTTAGAATCCCCCTTTAGCCGCAAACTAGATCTCTGGAATTTCCTTGATATTCCAAGAAGCCGTCTGGTGAAATACCCTCTGCTTCTTCG
AGAAATCTTGAGGCACACACCGAATGATAATCCAGATCAGCAGCACCTGGAAGAAGCT

Assemble


--------------------------------------------------------------------------------------------------------------------------
BGISUSX0000179894   : CTCCCTTGTCTTAGCTCCTATGACAGCTACTGCAGCAATCAAGTAGCTGCCAAGGCTCTGCTGGACCACAAGAAACAAGATCACCGAGTCCAAGACTTCC
rcbl0_017028.y1     : CTCCCTTGTCTTAGCTCCTATGACAGCTACTGCAGCAATCAAGTAGCTGCCAAGGCTCTGCTGGACCACAAGAAACAAGATCACCGAGTCCa@@------
CK453469            : CTCCCCTTTGCCCAAGCGCCGGAGTCTGGTCGAGCTAGGCTAGAAGCCGGCTGTCAGTCTCCGTGTAGCCGCAGCCGCCAGGCACCGTGGAGCTGGGGCC
rpfat_12634.y1      : CTCCCTTGTCTTAGCTCCTATGACAGCTACTGCAGCAATCAAGTAGCTGCCAAGGCTCTGCTGGACCACAAGAAACAAGATCACCGAGTCCAAGACTTCC
bla_23337.z1        : ------------AGCTCCTATGACAGCTACTGCAGCAATCAAGTAGCTGCCAAGGCTCTGCTGGACCACAAGAAACAAGATCACCGAGTCCAAGACTTCC

--------------------------------------------------------------------------------------------------------------------------
BGISUSX0000179894   : TACAGCGATGTTTAGAATCCCCCTTTAGCCGCAAACTAGATCTCTGGAATTTCCTTGATATTCCAAGAAGCCGTCTGGTGAAATACCCTCTGCTTCTTCG
rcbl0_017028.y1     : ----------------------------------------------------------------------------------------------------
CK453469            : CCCTTTCGCTTGggagttttgtggtcgtatcgggtcagcggtgacatcccaaagggcaggcccggcagccgccatggtggccaaggattatcccttctac
rpfat_12634.y1      : TACAGCGATGTTTAGAATCCCCCTTTAGCCGCAAACTAGATCTCTGGAATTTCCTTGATATTCCAAGAAGCCGTCTGGTGAAATACCCTCTGCTTCTTCG
bla_23337.z1        : TACAGCGATGTTTAGAATCCCCCTTTAGCCGCAAACTAGATCTCTGGAATTTCCTTGATATTCCAAGAAGCCGTCTGGTGAAATACCCTCTGCTTCTTCG

--------------------------------------------------------------------------------
BGISUSX0000179894   : AGAAATCTTGAGGCACACACCGAATGATAATCCAGATCAGCAGCACCTGGAAGAAGCT
rcbl0_017028.y1     : ----------------------------------------------------------
CK453469            : ctcactgtcaagagagcgaactgcagcctggaggtacccccggccagcagtccagcca
rpfat_12634.y1      : AGAAATCTTGAGGCACACACCGAATGATAATCCAGATCAGCAGCACCTGGAAGAAGCt
bla_23337.z1        : AGAAATCTTGAGGCACACACCGAATGATAATCCAGATCAGCAGCACCTGGAAGAAGCt

Cited by

ENST00000296315