Sequences

BGISUSX0000179910

Source Seq Type : all

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>BGISUSX0000179910
AGGCCTAAACGGCAGCGGCAAAACAACTTTCCCATGTTTCCATCTCCTAAAGCCTGGAATTTCAGAGGG

Assemble


-------------------------------------------------------------------------------------------
BGISUSX0000179910   : AGGCCTAAACGGCAGCGGCAAAACAACTTTCCCATGTTTCCATCTCCTAAAGCCTGGAATTTCAGAGGG
byf_37664.z1        : AGGCCTAAACGGCAGCGGCAAAACAACTTTCCCATGTTTCCATCTCCTAAAGCCTGGAATTTCAGAGGG

Cited by

ENST00000338458