Sequences

BGISUSX0000179915

Source Seq Type : all

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>BGISUSX0000179915
CGAAAGCGGAAGCAGAGCACCCAAGATGAAGATGCCGTTAGTCTTTGCAGTCTTGATATAAGT

Assemble


-------------------------------------------------------------------------------------
BGISUSX0000179915   : CGAAAGCGGAAGCAGAGCACCCAAGATGAAGATGCCGTTAGTCTTTGCAGTCTTGATATAAGT
CJ023267            : AGCCGTGGTTCGCTCTGCAGCCTAGCGGGTTGAGCCTGAGCTGGGCGCCGAGGAAGAAGACCT

Cited by

ENST00000338458