Sequences

BGISUSX0002000047

Source Seq Type : est

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>BGISUSX0002000047
AGATGTACAAAGATGATCAACGCTGATTCGGAGGACCCAAAGTACATTATCAATGTGAAGCAGTTTGCCAAGTTTGTGGTGGATCTCAGTGATCAGGTAG
CACCTACCGACATTGAAGAAGGGATGAGAGT

Assemble


--------------------------------------------------------------------------------------------------------------------------
BGISUSX0002000047   : AGATGTACAAAGATGATCAACGCTGATTCGGAGGACCCAA*AGTACATTATCAATGTGAAGCAGTTTGCCAAGTTTGTGGTGGATCTCA*GTGATCAGGT
rcje18_o13.y1       : AGATGTACAAAGATAATCAACGCTGATTCGGAGGACCCAAgAGTACATTATCAATGTGAAGCAGTTTGCCAAGTTTGTGGTGGATCTCA*GTGATCAGGT
rnlu1830b_f15.y1    : AGATGTACAAAGATAATCAACGCTGATTCGGAGGACCCAA*AGTACATTATCAATGTGAAGCAGTATGCCAAGTTTGTGGTGGATCT@------------
rche31_b14.y1       : AGATGTACAAAGATAATCAACGCTGATTCGGAGGACCCAA*AGTACATTATCAATGTGAAGCAGTTTGCCAAGTTTGTGGTGGATCTCA*GTGATCAGGT
rpldo0137_o21.y1    : AGATGTACAAAGATAATCAACGCTGATTCGGAGGACCCAA*AGTACATTATCAATGTGAAGCAGTATGCCAAGTTTGTGGTGGATCTCA*GTGATCAGGT
rcki22_o20.y1       : AGATGTACAAAGATAATCAACGCTGATTCGGAGGACCCAA*AGTACATTATCAATGTGAAGCAGTTTGCCAAGTTTGTGGTGGATCTCA*GTGATCAGGT
reep16c_i24.y1      : AGATGTACAAAGATGATCAACGCTGATTCGGAGGACCCAA*AGTACATTATCAATGTGAAGCAGTTTGCCAAGTTTGTGGTGGATCTCA*GTGATCAGGT
rnje06c_n3.y1       : ---------------------GCTGATTCGGAGGACCCAA*AGTACATTATCAATGTGAAGCAGTTTGCCAAGTTTGTGGTGGATCTCA*GTGATCAGGT
rcst39_b10.y1       : -------------------------------------------------------------------GCCAAGTTTGTGGTGGATCTCAcGTGATCAGGT

--------------------------------------------------------
BGISUSX0002000047   : A*GCACCTACCGACATTGAAGAAGGGATGAGAGT
rcje18_o13.y1       : AtGCACCTACCGACATTGAAGAAGGGATGAGAGT
rnlu1830b_f15.y1    : ----------------------------------
rche31_b14.y1       : A*GCACCTACCGACATTGAAGAAGGGATGA----
rpldo0137_o21.y1    : A*GCACCTACCGACATTGAAGAAGGGATGAGAG-
rcki22_o20.y1       : A*GCACCTACCGACATTGAAGAAGGGATGAGAG-
reep16c_i24.y1      : A*GCACCTACCGACATTGAAGAAGGGATGAGAG-
rnje06c_n3.y1       : A*GCACCTACCGACATTGAAGAAGGGATGAGAG-
rcst39_b10.y1       : A*GCACCTACCGAGATTGAACAAGGGATGAGAGT

Cited by

ENST00000292644