Sequences

BGISUSX0002000141

Source Seq Type : est

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>BGISUSX0002000141
TTGTTACTGGAGAATAGTGGTGTCCTAAACCAGATTTCTAACAAGAAAAATGAACAGTCTTCAGATCATTATAAACCCAAATCTTCAGAACTCTCGCTAA
AAGAAGTTAATGAAAACAGTGTATCAGTGGCATTGAGAAAAACCTCTGAAATCCTTCAGGATATTGACTCTCTTCTATCAAACTCCAAAAGGTAA

Assemble


--------------------------------------------------------------------------------------------------------------------------
BGISUSX0002000141   : TTGTTACTGGAGAATAGTGGTGTCCTAAACCAGATTTCTAACAAGAAAAATGAACAGTCTTCAGATCATTATAAACCCAAATCTTCAGAACTCTCGCTAA
rski0120_c9.y1      : TTGTTACTGGAGAATAGTGGTGTCCTAAACCATATTTCTAACAAGAAAGGTGAACAGTCTTCAGATCATTATAAACCCAAATCTTCAGAACTCTTGCTAA
rlin25_m23.y1       : TTGTTACTGGAGAATAGTGGTGTCCTAAACCATATTTCTAACAAGAAAAATGAACAGTCTTCAGATCATTATAAACCCAAATCTTCAGAACTCTTGCTAA
rlin17_l13.y1       : TTGTTACTGGAGAATAGTGGTGTCCTAAACCATATTTCTAACAAGAAAAATGAACAGTCTTCAGATCATTATAAACCCAAATCTTCAGAACTCTTGCTAA
rova008_c5.y1       : TTGTTACTGGAGAATAGTGGTGTCCTAAACCAGATTTCTAACAAGAAAAATGAACAGTCTTCAGATCATTATAAACCCAAATCTTCAGAACTCTCGCTAA
rtes11_p15.y1       : TTGTTACTGGAGAATAGTGGTGTCCTAAACCAGATTTCTAACAAGAAAAATGAACAGTCTTCAGATCATTATAAACCCAAATCTTCAGAACTCTCGCTAA
rcsk13_j21.y1       : TTGTTACTGGAGAATAGTGGTGTCCTAAACCAGATTTCTAACAAGAAAAATGAACAGTCTTCAGATCATTATAAACCCAAATCTTCAGAACGCTCGCTAA

---------------------------------------------------------------------------------------------------------------------
BGISUSX0002000141   : AAGAAGTTAATGAAAACAGTGTATCAGTGGCATTGAGAAAAACCTCTGAAATCCTTCAGGATATTGACTCTCTTCTATCAAACTCCAAAAGGTAA
rski0120_c9.y1      : AAGAAGTTAATGAAAACAGTGTATCAGTGGCATTGAGAAAAACCTCTGAAATCCTTCAGGATATTGACTCTCTTCTATCAAACTCCAAAAGGTAa
rlin25_m23.y1       : AAGAAGTTAATGAAAACAGTGTATCAGTGGCATTGAGAAAAACCTCTGAAATCCTTCAGGATATTGACTCTCTTCTATCAAACTCCAAAAGGTAa
rlin17_l13.y1       : AAGAAGTTAATGAAAACAGTGTATCAGTGGCATTGAGAAAAACCTCTGAAATCCTTCAGGATATTGACTCTCTTCTATCAAACTCCAGAAGGTAa
rova008_c5.y1       : AAGAAGTTAATGAAAACAGTGTATCAGTGGCATTGAGAAAAACCTCTGAAATCCTTCa@@-----------------------------------
rtes11_p15.y1       : AAGAAGTTAATGAAAACAGTGTATCAGTGGCATTGAGAAAAACCTCTGAAATCCTTCAGGATATTGACTCTCTTCTATCAAACTCCAAAAGGTAa
rcsk13_j21.y1       : AAGAAGTTAATGAAAACAGTGTATCAGTGGCATTGAGAAAAACCTCTGAAATCCTTCAGGATATTGACTCTCTTCTATCAAACTCCAAAAGGTAa

Cited by

ENST00000306862