Sequences

BGISUSX0002000286

Source Seq Type : est

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>BGISUSX0002000286
GGCTCAGAGCCCAAGATCCTCTTCTCCTACAAATGCCAAGTGGACGAGGCCGAGGAACCGGACATGCACCTGCCCCAGCCCTATGCGGTGGCCCGGCGGG
AGGGCCTGGAGGCGGCAGGGGCTGCCAGCACGCAGTTCGACTCGGCCAGTGGGGTGGCCTACCTGGATGACGTGGCTTCCATGCCGTGCCACGCAGGCAG
CATCAACAGCACAGACAGCGAGCGCTGGAAGGCCATCAATGCCT

Assemble


--------------------------------------------------------------------------------------------------------------------------
BGISUSX0002000286   : GGCTCAGAGCCCAAGATCCTCTTCTCCTACAAATGCCAAGTGGACGAGGCCGAGGAACCGGACATGCACCTGCCCCAGCCCTATGCGGTGGCCCGGCGGG
rmcp16c_p16.y1      : GGCTCAGAGCCCAAGATCCTCTTCTCCTACAAATGCCAAGTGGACGAGGCCGAGGAACCGGACATGCACCTGCCCCAGCCCTATGCGGTGGCCCGGCGGG
rnlu1802b_h24.y1    : GGCTCAGAGCCCAAGATCCTCTTCTCCTACAAATGCCAAGTGGACGAGGCCGAGGAACCGGACATGCACCTGCCCCAGCCCTATGCGGTGGCCCGGCGGG
rcov22b_m9.y1       : GGCTCAGAGCCCAAGATCCTCTTCTCCTACAAATGCCAAGTGGACGAGGCCGAGGAACCGGACATGCACCTGCCCCAGCCCTATGCGGTGGCCCGGCGGG
recc2820c_k10.y1    : GGCTCAGAGCCCAAGATCCTCTTCTCCTACAAATGCCAAGTGGACGAGGCCGAGGAACCGGACATGCACCTGCCCCAGCCCTATGCGGTGGCCCGGCGGG
rnca19b_n20.y1      : -GCTCAGAGCCCAAGATCCTCTTCTCCTACAAATGCCAAGTGGACGAGGCCGAGGAACCGGACATGCACCTGCCCCAGCCCTATGCGGTGGCCCGGCGGG
rnlu1813b_a23.y1    : ----------------------------------------------------------------------------------------------------

--------------------------------------------------------------------------------------------------------------------------
BGISUSX0002000286   : AGGGCCTGGAGGCGGCAGGGGCTGCCAGCACGCAGTTCGACTCGGCCAGTGGGGTGGCCTACCTGGATGACGTGGCTTCCATGCCGTGCCACGCAGGCAG
rmcp16c_p16.y1      : AGGGCCTGGAGg@@--------------------------------------------------------------------------------------
rnlu1802b_h24.y1    : AGGGCCTGGAGGCGGCAGGGGCTGCCAGCACGCAGTTCGACTCGGCCAGTGGGGTGGCCTACCTGCATGACGTGGCTTCCATGCCCTGCCACGCAGGCAG
rcov22b_m9.y1       : AGGGCCTGGAGGCGGCAGGGGCTGCCAGCACGCAGTTCGACTCGGCCAGTGGGGTGGCCTACCTGGATGACGTGGCTTCCATGCCGTGCCACGCAGGCAG
recc2820c_k10.y1    : AGGGCCTGGAGGCGGCAGGGGCTGCCAGCACGCAGTTCGACTCGGCCAGTGGGGTGGCCTACCTGGATGACGTGGCTTCCATGCCCTGCCACGCAGGCAG
rnca19b_n20.y1      : AGGGCCTGGAGGCGGCAGGGGCTGCCAGCACGCAGTTCGACTCGGCCAGTGGGGTGGCCTACCTGGATGACGTGGCTTCCATGCCCTGCCACGCAGGCAG
rnlu1813b_a23.y1    : --------------------------AGCACGCAGTTCGACTCGGCCAGTGGGGTGGCCTACCTGGATGACGTGGCTTCCATGCCCTGCCACGCAGGCAG

------------------------------------------------------------------
BGISUSX0002000286   : CATCAACAGCACAGACAGCGAGCGCTGGAAGGCCATCAATGCCT
rmcp16c_p16.y1      : --------------------------------------------
rnlu1802b_h24.y1    : CATCAACAGCACAGACAGCGAGCGCTGGAAGGCCATCAATGCCt
rcov22b_m9.y1       : CATCAACAGCACAGACAGCGAGCGCTGGAAGGCCATCAATGCCt
recc2820c_k10.y1    : CATCAACAGCACAGACAGCGAGCGCTGGAAGGCCATCAATGCCt
rnca19b_n20.y1      : CATCAACAGCACAGACAGCGAGCGCTGGAAGGCCATCAATGCCt
rnlu1813b_a23.y1    : CATCAACAGCACAGACAGCGAGCGCTGGAAGGCCATCAATGCCt

Cited by

ENST00000302066