Sequences

BGISUSX0002000292

Source Seq Type : est

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>BGISUSX0002000292
GCTCAGAGCCCAAGATCCTCTTCTCCTACAAATGCCAAGTGGACGAGGCCGAGGAACCGGACATGCACCTGCCCCAGCCCTATGCGGTGGCCCGGCGGGA
GGGCCTGGAGGCGGCAGGGGCTGCCAGCACGCAGTTCGACTCGGCCAGTGGGGTGGCCTACCTGGATGACGTGGCTTCCATGCCGTGCCACGCAGGCAGC
ATCAACAGCACAGACAGCGAGCGCTGGAAGGCCATCAATGCCT

Assemble


--------------------------------------------------------------------------------------------------------------------------
BGISUSX0002000292   : GCTCAGAGCCCAAGATCCTCTTCTCCTACAAATGCCAAGTGGACGAGGCCGAGGAACCGGACATGCACCTGCCCCAGCCCTATGCGGTGGCCCGGCGGGA
rnlu1802b_h24.y1    : GCTCAGAGCCCAAGATCCTCTTCTCCTACAAATGCCAAGTGGACGAGGCCGAGGAACCGGACATGCACCTGCCCCAGCCCTATGCGGTGGCCCGGCGGGA
rcov22b_m9.y1       : GCTCAGAGCCCAAGATCCTCTTCTCCTACAAATGCCAAGTGGACGAGGCCGAGGAACCGGACATGCACCTGCCCCAGCCCTATGCGGTGGCCCGGCGGGA
rmcp16c_p16.y1      : GCTCAGAGCCCAAGATCCTCTTCTCCTACAAATGCCAAGTGGACGAGGCCGAGGAACCGGACATGCACCTGCCCCAGCCCTATGCGGTGGCCCGGCGGGA

--------------------------------------------------------------------------------------------------------------------------
BGISUSX0002000292   : GGGCCTGGAGGCGGCAGGGGCTGCCAGCACGCAGTTCGACTCGGCCAGTGGGGTGGCCTACCTGGATGACGTGGCTTCCATGCCGTGCCACGCAGGCAGC
rnlu1802b_h24.y1    : GGGCCTGGAGGCGGCAGGGGCTGCCAGCACGCAGTTCGACTCGGCCAGTGGGGTGGCCTACCTGCATGACGTGGCTTCCATGCCCTGCCACGCAGGCAGC
rcov22b_m9.y1       : GGGCCTGGAGGCGGCAGGGGCTGCCAGCACGCAGTTCGACTCGGCCAGTGGGGTGGCCTACCTGGATGACGTGGCTTCCATGCCGTGCCACGCAGGCAGC
rmcp16c_p16.y1      : GGGCCTGGAGg@@---------------------------------------------------------------------------------------

-----------------------------------------------------------------
BGISUSX0002000292   : ATCAACAGCACAGACAGCGAGCGCTGGAAGGCCATCAATGCCT
rnlu1802b_h24.y1    : ATCAACAGCACAGACAGCGAGCGCTGGAAGGCCATCAATGCCt
rcov22b_m9.y1       : ATCAACAGCACAGACAGCGAGCGCTGGAAGGCCATCAATGCCt
rmcp16c_p16.y1      : -------------------------------------------

Cited by

ENST00000358942