Sequences

BGISUSX0002000544

Source Seq Type : est

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>BGISUSX0002000544
GGCCCATCGGTCTACCCTCTGGCCCCCTGCGGCAGGGACACGTCTGGCCCTAACGTGGCCTTGTGGCTGCCTGGCCTCAAGCTACTTCCCCGAGCCAGTG
ACCGTGACCTGGAACTCGGGCGCCCTGACCAGTGGCGTGCACACCTTCCCATCCGTCCTGCAGCCGTCAGGGCTCTACTCCCTCAGCAGCATGGTGACCG
TGCCGGCCAGCAGCCTGTCCAGCAAGAGCTACACCTGCAATGTCAACCACCCGGCCACCACCACCAAGGTGGACAAGCGTGTT

Assemble


--------------------------------------------------------------------------------------------------------------------------
BGISUSX0002000544   : GGCCCATCGGTCTACCCTCTGGCCCCCTGCGGCAGGGACACGTCTGG*CCCTAACGTGGCCTTGTGGCTGCCTGGCCTCAA*GCTACTTCCCCGAGCCAG
rcad08b_p12.y1      : GGCCCATCGGTCTACCCTCTGGCCCCCTGCGGCAGGGACACGTCTGGgCCCTAACGTGGCCTTGtGGCTGCCTGGCCTCAA*GCTACTTCCCCGAGCCAG
rcly26b_c17.y1      : GGCCCATCGGTCTACCCTCTGGCCCCCTGCGGCAGGGACACGTCTGG*CCCTAACGTGGCCTTG*GGCTGCCTGGCCTCAA*GCTACTTCCCCGAGCCAG
rcly20b_f2.y1       : -------------------------------------------------------GTGGCCTTGtGGCTGCCTGGCCTCAA*GCTACTTCCCCGAGCCAG
rcsp21b_e9.y1       : -------------------------------------------------------GTGGCCTTG*GGCTGCCTGGCCTCAA*GCTACTTCCCCGAGCGAG
rcly09b_p19.y1      : ---------------------------------------------------------GGCCTTG*GGCTGCCTGGCCTCAA*GCTACTTCCCCGAGCCAG
rcsp22b_k10.y1      : ----------------------------------------------------------------gagGTGCCTGGCCTCAAtGCTACTTCCCCGAGCCAG
rpigcb_2672.y1      : ----------------------------------------------------------------GGGCTGCCTGGCCTCAA*GCTACTTCCCCGAGCCAG
rpigcb_9761.y1      : ------------------------------------------------------------------GCTGCCTGGCCTCAA*GCTACTTCCCCGAGCCAG
rcly21b_j14.y1      : -----------------------------------------------------------------------CTGGCCTCAA*GCTACTTCCCCGAGCCAG
rcly21b_n3.y1       : -----------------------------------------------------------------------CTGGCCTCAA*GCTACTTCCCCGAGCCAG
rcbl0_014322.y1     : ----------------------------------------------------------------------------cgagg*GCTACTTCCCCGAGCCAG
rcly15b_o1.y1       : -----------------------------------------------------------------------------------CTACTTCCCCGAGCCAG
rcly06b_i17.y1      : -----------------------------------------------------------------------------------CTACTTCCCCGAGCCAG
rcly21b_m18.y1      : --------------------------------------------------------------------------------g*GCTACTTCCCCGAGCCAG
rpigca0_010741.y1   : -----------------------------------------------------------------------------------CTACTTCCCCGAGCCAG
rcad09b_p14.y1      : -----------------------------------------------------------------------------------CTACTTCCCCGAGCCAG
rcly22b_j4.y1       : -----------------------------------------------------------------------------------CTACTTCCCCGAGCCAG
rcly13b_b20.y1      : -----------------------------------------------------------------------------------CTACTTCCCCGAGCCAG
rcly06b_p9.y1       : -------------------------------------------------------------------------------------------cggcacgag
rcly28b_c14.y1      : --------------------------------------------------------------------------------------CTTCCCCGAGCCAG
rcly32b_a13.y1      : ---------------------------------------------------------------------------------------TTCCCCGAGCCAG
rcad06b_o14.y1      : -----------------------------------------------------------------------------------------CCCCGAGCCAG
rcly32b_f1.y1       : ------------------------------------------------------------------------------------------CCCGAGCCAG
rcbl0_021288.y1     : ------------------------------------------------------------------------------------------CCCGAGCCAG
rcly34b_g1.y1       : ---------------------------------------------------------------------------------------------GAGCCAG
rpigcb_2168.y1      : ---------------------------------------------------------------------------------------------GAGCCAG
rcly11b_l8.y1       : ---------------------------------------------------------------------------------------------GAGGCAG
rcly21b_o22.y1      : --------------------------------------------------------------------------------------------------GG
rcsp26b_m24.y1      : ----------------------------------------------------------------------------------------------------
rcly25b_e2.y1       : ----------------------------------------------------------------------------------------------------
rcsp12b_g16.y1      : ----------------------------------------------------------------------------------------------------
rcly26b_o9.y1       : ----------------------------------------------------------------------------------------------------
rcly36b_g20.y1      : ----------------------------------------------------------------------------------------------------
rcsp24b_b20.y1      : ----------------------------------------------------------------------------------------------------
rcad07b_g10.y1      : ----------------------------------------------------------------------------------------------------
rcly38b_e4.y1       : ----------------------------------------------------------------------------------------------------
rcsp30b_k17.y1      : ----------------------------------------------------------------------------------------------------
rcsp24b_d19.y1      : ----------------------------------------------------------------------------------------------------
rcly10b_g6.y1       : ----------------------------------------------------------------------------------------------------
rcsp37b_f6.y1       : ----------------------------------------------------------------------------------------------------
rcly22b_o4.y1       : ----------------------------------------------------------------------------------------------------
rcly38b_n6.y1       : ----------------------------------------------------------------------------------------------------
rcly30b_l20.y1      : ----------------------------------------------------------------------------------------------------
rcly34b_f3.y1       : ----------------------------------------------------------------------------------------------------
rcad13b_m19.y1      : ----------------------------------------------------------------------------------------------------
rcsp18b_k7.y1       : ----------------------------------------------------------------------------------------------------
rcly28b_c11.y1      : ----------------------------------------------------------------------------------------------------
rcsp16b_e6.y1       : ----------------------------------------------------------------------------------------------------
rcly07b_g9.y1       : ----------------------------------------------------------------------------------------------------
rcli06b_f3.y1       : ----------------------------------------------------------------------------------------------------
rcly13b_n20.y1      : ----------------------------------------------------------------------------------------------------
rpigcb_11807.y1     : ----------------------------------------------------------------------------------------------------
rcly27b_n14.y1      : ----------------------------------------------------------------------------------------------------
rcly09b_h19.y1      : ----------------------------------------------------------------------------------------------------
rcly24b_j21.y1      : ----------------------------------------------------------------------------------------------------
rlnt16c_g15.y1      : ----------------------------------------------------------------------------------------------------
rcly07b_o2.y1       : ----------------------------------------------------------------------------------------------------
rcsp21b_b20.y1      : ----------------------------------------------------------------------------------------------------
rcsp26b_c16.y1      : ----------------------------------------------------------------------------------------------------
rcsp33b_m19.y1      : ----------------------------------------------------------------------------------------------------
rcly12b_p7.y1       : ----------------------------------------------------------------------------------------------------
rcly11b_b13.y1      : ----------------------------------------------------------------------------------------------------
rlnt32c_p13.y1      : ----------------------------------------------------------------------------------------------------
rpigcb_13418.y1     : ----------------------------------------------------------------------------------------------------
rpigca0_014388.y1   : ----------------------------------------------------------------------------------------------------
rcly23b_c4.y1       : ----------------------------------------------------------------------------------------------------
rcad25b_n8.y1       : ----------------------------------------------------------------------------------------------------
rcbl0_003557.y1     : ----------------------------------------------------------------------------------------------------
rcly36b_p24.y1      : ----------------------------------------------------------------------------------------------------

--------------------------------------------------------------------------------------------------------------------------
BGISUSX0002000544   : TGACC*GT*GACCTGG*AACTCG*GGCGCCCTGACCAGTGGC*GTGCACACCTT*CC*C**A*TCC*GT*C*CTGCAGCC*GTCAG*GGCTCTACTCC*C
rcad08b_p12.y1      : TGACC*GT*GACCTGG*AACTCG*GGCGCCCTGACCAGTGGC*GTGCACACCTT*CC*C**A*TCC*GT*C*CTGCAGCC*GTCAG*GGCTCTACTCC*C
rcly26b_c17.y1      : TGACC*GT*GACCTGG*AACTCG*GGCGCCCTGACCAGTGGC*GTGCACACCTT*CC*C**A*TCC*GT*C*CTGCAGCC*GTCAG*GGCTCTACTCC*C
rcly20b_f2.y1       : TGACC*GGgGACCTGG*AACTCG*GGCGCCCTGACCAGTGGCtGTGCACACCTT*CC*C**A*TCC*GT*C*CTGCAGCC*GTCAG*GGCTCTACTCC*C
rcsp21b_e9.y1       : TGACC*GT*GACCTGN*AACTCG*GGCGCCCTGACCAGTGGC*GTGCATACCTT*CC*C**A*TCC*GT*C*CTGCAGCC*GTCAG*GGCTCTACTCC*C
rcly09b_p19.y1      : TGACC*GT*GACCTGG*AACTCG*GGCGCCCTGACCAGTGGC*GTGCACACCTT*CC*C**A*TCC*GT*C*CTGCAGCC*GTCAG*GGCTCTACTCC*C
rcsp22b_k10.y1      : TGACCTGT*GACCTGG*AACTCG*GGCGCCCTGACCAGTGGCtGTGCACACCTT*CC*C**A*TCC*GT*C*CTGCAGCC*GTCAG*GGCTCTACTCC*C
rpigcb_2672.y1      : TGACC*GT*GACCTGG*AACTCG*GGCGCCCTGACCAGTGGC*GTGCATACCTT*CC*C**A*TCC*GT*C*CTGCAGCC*GTCAG*GGCTCTACTCC*C
rpigcb_9761.y1      : TGACC*GT*GACCTGG*AACTCG*GGCGCCCTGACCAGTGGC*GTGCATACCTT*CC*C**A*TCC*GT*C*CTGCAGCC*GTCAG*GGCTCTACTCC*C
rcly21b_j14.y1      : TGACCTGT*GACCTGG*AACTCGtGGCGCCCTGACCAGTGGC*GTGCACACCTT*CC*C**A*TCC*GT*C*CTGCAGCC*GTCAG*GGCTCTACTCC*C
rcly21b_n3.y1       : TGACC*GT*GACCTGG*AACTCG*GGCGCCCTGACCAGTGGC*GTGCACACCTT*CC*C**A*TCC*GT*C*CTGCAGCC*GTCAG*GGCTCTACTCC*C
rcbl0_014322.y1     : TGACCtGT*GACCTGG*AACTCG*GGCGCCCTGACCAGTGGCtGTGCATACCTT*CC*C**A*TCC*GT*C*CTGCAGCCTGTCAG*GGCTCTACTCC*C
rcly15b_o1.y1       : TGACCTGT*GACCTGG*AACTCGtGGCGCCCgGAcCAGTGGCtGTGCATACCTT*CC*C**A*TCC*GT*C*CTGCAGCC*GTCAG*GGCTCTACTCC*C
rcly06b_i17.y1      : TGACCTGT*GACCTGG*AACTCG*GGCGCCCTGACCAGTGGCtGTGCACACCTT*CC*C**A*TCCtGT*C*CTGCAGCC*GTCAG*GGCTCTACTCC*C
rcly21b_m18.y1      : TGACC*GT*GACCTGG*AACTCG*GGCGCCCTGACCAGGGGC*GTGCACACCTT*CC*C**A*TCC*GT*C*CTGCAGCC*GTCAG*GGCTCTACTCC*C
rpigca0_010741.y1   : TGACCTGT*GACCTGG*AACTCG*GGCGCCCTGACCAGTGGC*GTGCACACCTT*CC*C**A*TCC*GT*C*CTGCAGCC*GTCAG*GGCTCTACTCC*C
rcad09b_p14.y1      : TGACC*GT*GACCTGG*AACTCG*GGCGCCCTGACCAGTGGC*GTGCATACCTT*CC*C**A*TCC*GT*C*CTGCAGCC*GTCAG*GGCTCTACTCC*C
rcly22b_j4.y1       : TGACC*GT*GACCTGG*AACTCG*GGCGCCCTGAgCAGTGGC*GTGCACACCTT*CC*C**A*TCC*GT*C*CTGCAGCC*GTCAG*GGCTCTACTCC*C
rcly13b_b20.y1      : TGACC*GT*GACCTGG*AACTCG*GGCGCCCTGACCAGTGGC*GTGCACACCTT*CC*C**A*TCC*GT*C*CTGCAGCC*GTCAG*GGCTCTACTCC*C
rcly06b_p9.y1       : GGACC*GT*GACCTGGaAACTCG*GGCGCCCTGACCAGTGGCtGTGCACACCTT*TC*CggA*TCCtGT*C*CTGCAGCCTGTCAG*GGCTCTACTCC*C
rcly28b_c14.y1      : TGACC*GT*GACCTGG*AACTCG*GGCGCCCTGACCAGGGGC*GTGCACACCTT*CC*C**A*TCC*GT*C*CTGCAGCC*GTCAG*GGCTCTACTCC*C
rcly32b_a13.y1      : TGACC*GT*GACCTGA*AACTCG*GGCGCCCTGACCAGTGGC*GTGCACACCTT*CC*C**A*TCC*GT*C*CTGCAGCC*GTCAG*GGCTCTACTCC*C
rcad06b_o14.y1      : TGACC*GT*GACCTGG*AACTCG*GGTGCCCTGTCCAGAGTC*GTGCATACCTT*CC*C**A*TCT*GT*C*CTGCAGCC*GTCAG*GGCTCTACTCC*C
rcly32b_f1.y1       : TGACC*GT*GACCTGG*AACTCG*GGCGCCCTGACCAGTGGC*GTGCACACCTT*CC*C**A*TCC*GT*C*CTGCAGCC*GTCAG*GGCTCTACTCC*C
rcbl0_021288.y1     : TGACC*GT*GACCTGG*AACTCG*GGCGCCCTGACCAGTGGC*GTGCACGCCTT*CC*C**A*TCC*GT*C*CTGCAGCC*GTCAG*GGCTCTACTCC*C
rcly34b_g1.y1       : TGACC*GT*GACCTGG*AACTCG*GGCGCCCTGACCAGTGGC*GTGCATACCTT*CC*C**A*TCC*GT*C*CTGCAGCC*GTCAG*GGCTCTACTCC*C
rpigcb_2168.y1      : TGACC*AT*GACCTGG*AACTCG*GGCGCCCTGACCAGTGGC*GTGCATACCTT*CC*C**A*TCC*GT*C*CTGCAGCC*GTCAG*GGCTCTACTCC*C
rcly11b_l8.y1       : TGACC*GT*GACCTGG*AACTCG*GGCGCCCTGACCAGTGGC*GTGCACACCTT*CC*C**A*TCC*GT*C*CTGCAGCC*GTCAG*GGCTCTACTCC*C
rcly21b_o22.y1      : TGACC*GT*GACCTGG*AACTCG*GGCGCCCTGACCAGTGGC*GTGCACACCTT*CC*C**A*TCC*GT*C*CTGCAGCC*GTCAG*GGCTCTACTCC*C
rcsp26b_m24.y1      : -gagg*GT*GACCTGG*AACTCG*GGCGCCCTGACCAGTGGC*GTGCATACCTT*CC*C**A*TCC*GTtCgCTGCAGCC*GTCAG*GGCTCTACTCC*C
rcly25b_e2.y1       : --acg*ag*gACCTGG*AACTCG*GGCGCCCTGACCAGTGGCtGTGCATACCTT*CC*C**A*TCC*GT*C*CTGGAGCC*GTCAG*GGCTCTACTCC*C
rcsp12b_g16.y1      : --ACC*GT*GACCTGG*AACTCG*GGCGCCCTGACCAGTGGC*GTGCATACCTT*CC*C**AgTCC*GT*C*CTGCAGCC*GTCAG*GGCTCTACTCC*C
rcly26b_o9.y1       : -gagg*GT*GACCTGG*AACTCG*GGCGCCCTGACCAGTGGC*GTGCATACCTT*CC*C**A*TCC*GT*C*CTGCAGCC*GTCAG*GGCTCTACTCC*C
rcly36b_g20.y1      : -gagg*GT*GACCTGG*AACTCG*GGCGCCCTGACCAGTGGC*GTGCACACCTT*CC*C**A*TCC*GT*C*CTGCAGCC*GTCAG*GGCTCTACTCC*C
rcsp24b_b20.y1      : -gGCC*GT*GACCTGG*AACTCG*GGCGCCCTGACCAGTGGC*GTGCACACCTT*CC*C**A*TCG*GT*G*CTGCAGCC*GTCAG*GGCTCTACTCC*C
rcad07b_g10.y1      : -gagg*GT*GAGCTGG*AACTCG*GGCGCCCTGACCAGTGGC*GTGCACACCTT*CC*C**A*TCC*GT*C*CTGCAGCC*GTCAG*GGCTCTACTCC*C
rcly38b_e4.y1       : -------------TGG*AACTCG*GGCGCCCTGACCAGTGGCtGTGCATACCTT*CC*C**A*TCC*GT*C*GTGCAGCCtGTCAG*GGCTCTACTCC*C
rcsp30b_k17.y1      : ------------GTGG*AACTCG*GGCGCCCTGACCAGTGGCtGTGCATACCTT*CC*C**A*TCC*GT*C*CTGCAGCC*GTCAG*GGCTCTACTCC*C
rcsp24b_d19.y1      : -------------TGG*AACTCG*GGCGCCCTGACCAGTGGC*GTGCATACCTTgCCgC**A*TCC*GT*C*CTGCAGCC*GTCAG*GGCTCTACTCC*C
rcly10b_g6.y1       : --------------GG*AACTCG*GGCGCCCTGACCAGTGGCtGTGCATACCTT*CC*C**A*TCC*GT*C*CTGCAGCC*GTCAG*GGCTCTACTCC*C
rcsp37b_f6.y1       : --------------GG*AACTCG*GGCGCCCtGA*CAGTGGC*GTGCACACCTT*CC*C**A*TCC*GT*C*CTGCAGGCgGTCAG*GGCTCTACTCC*C
rcly22b_o4.y1       : --------------GG*AACTCG*GGCGCCCTGACCAGTGGC*GTGCATACCTT*CC*C**A*TCC*GT*C*CTGCAGCC*GTCAG*GGCTCTACTCC*C
rcly38b_n6.y1       : --------------GG*AACTCG*GGCGCCCTGACCAGTGGC*GTGCACACCTT*CC*C**A*TCC*GT*C*CTGCAGCC*GTCAG*GGCTCTACTCC*C
rcly30b_l20.y1      : -------------TGG*AACTCG*GGCGCCC*GAcCAGTGGC*GTGCACACCTT*CC*C**A*TCC*GT*C*CTGCAGCC*GTCAG*GGCTCTACTCC*C
rcly34b_f3.y1       : -------------------CTCG*GGCGCCCTGACCAGTGGC*GTGCATACCTT*CC*C**A*TCC*GT*C*CTGCAGCC*GTCAG*GGCTCTACTCC*C
rcad13b_m19.y1      : --------------------------CGCCCTGACCAGTGGCtGTGCATACCTT*CC*C**A*TCCtGT*C*CTGCAGCCTGTCAGtGGCTCTACTCC*C
rcsp18b_k7.y1       : ------------------------GGCGCCCtGACCAGTGGCtGTGCACACCTT*CC*C**A*TCC*GT*C*CTGCAGCC*GTCAG*GGCTCTACGCGgC
rcly28b_c11.y1      : ---------------------------GCCCtGACCAGTGGC*GTGCACACCTT*CC*C**A*TCC*GT*C*CTGCAGCC*GTCAG*GGCTCTACTCC*C
rcsp16b_e6.y1       : ---------------------------------acgagGGGC*GTGCATACCTT*CC*C**A*TCC*GT*C*CTGCAGCC*GTCAG*GGCTCTACTCC*C
rcly07b_g9.y1       : ---------------------------------acgagGGGC*GTGCACACCTT*CC*C**A*TCC*GT*C*CTGCAGCC*GTCAG*GGCTCTACTCC*C
rcli06b_f3.y1       : ---------------------------------------------GCATACCTT*CC*C**A*TCC*GT*C*CTGCAGCC*GTCAG*GGCTCTACTCC*C
rcly13b_n20.y1      : ---------------------------------------------GCACACCTT*CC*C**A*TCC*GT*C*CTGCAGCC*GTCAG*GGCTCTACTCC*C
rpigcb_11807.y1     : -------------------------------------------------ACCTT*CC*C**A*TCC*GT*C*CTGCAGCC*GTCAG*GGCTCTACTCC*C
rcly27b_n14.y1      : -------------------------------------------------------CC*C**A*TCC*GT*C*CTGCAGCC*GTCAG*GGCTCTACTCC*C
rcly09b_h19.y1      : -------------------------------------------------------------------GT*C*CTGCAGCC*GTCAG*GGCTCTACTCC*C
rcly24b_j21.y1      : -------------------------------------------------------------------GT*C*CTGCAGCC*GTCAG*GTCTCTACTCC*C
rlnt16c_g15.y1      : ---------------------------------------------------------------------------CAGCC*GTCAG*GGCTCTACTCC*C
rcly07b_o2.y1       : ---------------------------------------------------------------------------CAGCC*GTCAG*GGCTCTACTCC*C
rcsp21b_b20.y1      : ----------------------------------------------------------------------------------TCAG*GGCTCTACTCC*C
rcsp26b_c16.y1      : -----------------------------------------------------------------------------------cac*gaggCTACTCC*C
rcsp33b_m19.y1      : -----------------------------------------------------------------------------------CAG*GGCTCTACTCC*C
rcly12b_p7.y1       : ---------------------------------------------------------------------------------------GGCTCTACTCC*C
rcly11b_b13.y1      : ----------------------------------------------------------------------------------------------CTCC*C
rlnt32c_p13.y1      : -------------------------------------------------------------------------------------------------C*C
rpigcb_13418.y1     : ----------------------------------------------------------------------------------------------------
rpigca0_014388.y1   : ----------------------------------------------------------------------------------------------------
rcly23b_c4.y1       : ----------------------------------------------------------------------------------------------------
rcad25b_n8.y1       : ----------------------------------------------------------------------------------------------------
rcbl0_003557.y1     : ----------------------------------------------------------------------------------------------------
rcly36b_p24.y1      : ----------------------------------------------------------------------------------------------------

--------------------------------------------------------------------------------------------------------------------------
BGISUSX0002000544   : TCAGC*AGC*ATG*GTGACC*GTGCC*GGCCAGCAGCCTGTCCAGCAAGAGCTACACCTGCAATGTCAACCACCCGGCCACCACCACCAAGGTGGACAAG
rcad08b_p12.y1      : TCAGC*AGC*ATG*GTGACC*GTGCC*GGCCAGCAGCCTGTCCAGCAAGAGCTACACCTGCAATGTCAACCACCCGGCCACCACCA--------------
rcly26b_c17.y1      : TCAGC*AGC*ATG*GTGACC*GTGCC*GGCCAGCAGCCTGTCCAGCAAGAGCTACACCTGCAATGTCAACCACCCGGCCACCAC----------------
rcly20b_f2.y1       : TCAGC*AGC*ATG*GTGACC*GTGCC*GGCCAGCAGCCTGTCCAGCAAGAGCTACACCTGCAATGTTAACCACCCGGCCACCACCACC------------
rcsp21b_e9.y1       : TCAGC*AGC*ATG*GTGACC*GTGCC*GGCCAGCAGCCTGTCCAGCAAGAGCTACACCTGCAAGGTGAACCACCCGGCCACCACC---------------
rcly09b_p19.y1      : TCAGC*AGC*ATG*GTGACC*GTGCC*GGCCAGCAGCCTGTCCAGCAAGAGCTACACCTGCAATGTCAACCACCCGGCCACCACC---------------
rcsp22b_k10.y1      : TCAGC*AGC*ACG*G-------------------------------------------------------------------------------------
rpigcb_2672.y1      : TCAGC*AGC*ATG*GTGACC*GTGCC*GGCCAGCAGCCTGTCCAGCAAGAGCTACACCTGCAATGTCAACCACCCGGCCACCACCA--------------
rpigcb_9761.y1      : TCAGC*AGC*ATG*GTGACC*GTGCC*GGCCAGCAGCCTGTCCAGCAAGAGCTACACCTGCAATGTCAACCACCCGGCCACCAGCA--------------
rcly21b_j14.y1      : TCAGC*AGC*ATG*GTGACC*GTGCC*GGCCAGCAGCCTGTCCAGCAAGAGCTACACCTGCAATGTCAACCACCCGGCCACCACCACC------------
rcly21b_n3.y1       : TCAGC*AGC*ATG*GTGACC*GTGCC*GGCCAGCAGCCTGTCCAGCAAGAGCTACACCTGCAATGTCAACCACCCGGCCACCACCA--------------
rcbl0_014322.y1     : TCAGC*AGC*ATG*GTGACC*GTGCC*GGCCAGCAGCCTGTCCAGCAAGAGCTACACCTGCAATGTCAACCACCCGGCCACCACCACCA-----------
rcly15b_o1.y1       : TCAGC*AGC*ATG*GTGACC*GTGCC*GGCCAGCAGCCTGTCCAGCAAGAGCTACACCTGCAATGTCAACCACCCGGCCACCACCACCA-----------
rcly06b_i17.y1      : TCAGC*AGC*ATG*GTGACC*GTGCC*GGCCAGCAGCCTGTCCAGCAAGAGCTACACCTGCAATGTCAACCACCCGGCCACCACCACCAA----------
rcly21b_m18.y1      : TCAGC*AGC*ATG*GTGACC*GTGCC*GGCCAGCAGCCGGTCCAGCAAGAGCTACACCTGCAATGTCAACCACCCGGCCACCACC---------------
rpigca0_010741.y1   : TCAGC*AGC*ATG*GTGACC*GTGCC*GGCCAGCAGCCTGTCCAGCAAGAGCTAC---------------------------------------------
rcad09b_p14.y1      : TCAGC*AGC*ATG*GTGACC*GTGCC*GGCCAGCAGCCTGTCCAGCAAGAGCTACACCTGCAATGTCAACCACCCGGCCACCACCAC-------------
rcly22b_j4.y1       : TCAGC*AGC*ATG*GTGACC*GTGCC*GGCCAGCAGCCTGTCCAGCAAGAGCTGCACCTGCAATGTCAACCACCCGGCCACCACCAC-------------
rcly13b_b20.y1      : TCAGC*AGC*ATG*GTGACC*GTGCC*GGCCAGCAGCCTGTCCAGCAAGAGCTACACCTGCAATGTCAACCACCCGGCCACCACCAC-------------
rcly06b_p9.y1       : TCAGC*AGC*ATG*GTGACC*GTGCC*GGCCAGCAGCCTGTCCAGCAAGAGCTACACCTGCAATGTCAACCACCCGGCCACCACCACCAAGGT-------
rcly28b_c14.y1      : TCAGC*AGC*ATG*GTGACC*GTGCC*GGCCAGCAGCCTGTCCAGCAAGAGCTACACCTGCAAGGTCAACCACCCGGCCACCACCA--------------
rcly32b_a13.y1      : TCAGC*AGC*ATG*GTGACC*ATGCC*GGCCAGCAGCCTGTCCAGCAAGAGCTACACCTGCAATGTCAACCACCCGGCCACCACCAC-------------
rcad06b_o14.y1      : TCAGC*AGC*ATG*GTGATC*GTGGC*GGCCAGCAGCCTGTCCACCCTGAGCTACACGTGCAACGTCTACCACCCGGCCACCAACAC-------------
rcly32b_f1.y1       : TCAGC*AGC*ATG*GTGACC*GTGCC*GGCCAGCAGCCTGTCCAGCAAGAGCTACACCTGCAATGTCAACCACCCGGCCACCACCAC-------------
rcbl0_021288.y1     : TCAGC*AGC*ATG*GTGACC*GTGCC*GGCCAGCAGCCTGTCCAGCAAGAGCTACACCTGCAATGTCAACCACCCGGCCACCACCAC-------------
rcly34b_g1.y1       : TCAGC*AGC*ATG*GTGACC*GTGCC*GGCCAGCAGCCTGTCCAGCAAGAGCTACACCTGCAATGTCAACCACCCGGCCACCACCAC-------------
rpigcb_2168.y1      : TCAGC*AGC*ATG*GTGACC*GTGCC*GGCCAGCAGCCTGTCCAGCAAGAGCTACACCTGCAATGTCAACCACCCGGCCACCACCAC-------------
rcly11b_l8.y1       : TCAGC*AGC*ATG*GTGACC*GTGCC*GGCCAGCAGCCTGTCCAGCAAGAGCTACACCTGCAATGTCAACCACCCGGCCACCACCAC-------------
rcly21b_o22.y1      : TCAGC*AGC*ATG*GTGACC*GTGCC*GGCCAGCAGCCTGTC----------------------------------------------------------
rcsp26b_m24.y1      : TCAGC*AGC*ATG*GTGACC*GTGCC*GGCCAGCAGCCTGTCCAGCAAGAGCTACACCTGCAATGTCAACCACCCGGCCACCACCACCA-----------
rcly25b_e2.y1       : TCAGC*AGC*ATG*GTGACC*GTGCC*GGCCAGCAGCCTGTCCAGCAAGAGCTACACCTGCAATGTCAACCACCCGGCCACCACCACC------------
rcsp12b_g16.y1      : TCAGC*AGC*ATG*GTGACC*GTGCC*GGCCAGCAGCCTGTCCAGCAAGAGCTACACCTGCAATGTCAACCACCCGGCCACCACCACC------------
rcly26b_o9.y1       : TCAGC*AGC*ATG*GTGACC*GTGCC*GGCCAGCAGCCTGTCCAGCAAGAGCTACACCTGCAATGTCAACCACCCGGCCACCACCAC-------------
rcly36b_g20.y1      : TCAGC*AGC*ATG*GTGACC*GTGCC*GGCCAGCAGCCTGTCCAGCAAGAGCTACACCTGCAATGTCAACCACCCGGCCACCACCAC-------------
rcsp24b_b20.y1      : TCAGC*AGC*ATG*GTGACC*GTGCC*GGCCAGCAGCCTGTCCAGCAAGAGCTACACCTGCAATGTCAACCACCCGGCCACCACCAC-------------
rcad07b_g10.y1      : TCAGC*AGC*ATG*GTGACC*GTGCC*GGCCAGCAGCCTGTCCAGCAAGAGCTACACCTGCAATGTCAACCACCCGGCCACCACCAC-------------
rcly38b_e4.y1       : TCAGC*AGC*ATG*GTGACCTGTGCCt-------------------------------------------------------------------------
rcsp30b_k17.y1      : TCAGC*AGC*ATG*GTGACC*GTGCC*GGCCAGCAGCCTGTCCAGCAAGAGCTACACCTGCAATGTCAACCACCCGGCCACCACCACCAA----------
rcsp24b_d19.y1      : TCAGC*AGC*ATG*GTGACC*GTGCC*GGCCAGCAGCCTGTCCAGCAAGAGCTACACCTGCAATGTCAACCACCCGGCCACCACCACCAA----------
rcly10b_g6.y1       : TCAGC*AGC*ATG*GTGACC*GTGCC*GGCCAGCAGCCTGTCCAGCAAGAGCTACACCTGCAATGTCAACCACCCGGCCACCACCACCAA----------
rcsp37b_f6.y1       : TCAGC*AGC*ATG*GTGACC*GTGCCtGGCCAGCAGCCTGTCCAGCAAGAGCTACA--------------------------------------------
rcly22b_o4.y1       : TCAGC*AGC*ATG*GTGACC*GTGCC*GGCCAGCAGCCTGTCCAGCAAGAGCTACACCTGCAATGTCAACCACCCGGCCACCACCACCA-----------
rcly38b_n6.y1       : TCAGC*AGC*ATG*GTGACC*GTGCC*GGCCAGCAGCCTGTCCAGCAAGAGCTACACCTGCAATGTCAACCACCCGGCCACCACCACCA-----------
rcly30b_l20.y1      : TCAGC*AGC*ATG*GTGACC*GTGCC*GGCCAGCAGCCTGTCCAGCAAGAGCTACACCTGCAATGTCAACCACCCGGCCACCACCACC------------
rcly34b_f3.y1       : TCAGC*AGC*ATG*GTGACC*GTGCC*GGCCAGCAGCCTGTCCAGCAAGAGCTACACCTGCAATGTCAACCACCCGGCCACCACCACCAA----------
rcad13b_m19.y1      : TCAGC*AGC*ATG*GTGACC*GTGCC*GGCCAGCAGCCTGTCCAGCAAGAGCTACACCTGCAATGTCAACCACCCGGCCACCACCACCAAGGTGG-----
rcsp18b_k7.y1       : TCAGC*AGC*ATG*GTGACC*GTGCC*GGCCAGCAGCCTGTCCAGCAAGAGCTACACCTGCAATGTCAACCACCCGGCCACCACCACCAAGGT-------
rcly28b_c11.y1      : TCAGC*AGC*ATG*GTGACC*GTGCC*GGCCAGCAGCCTGTCCAGCAAGAGCTACACCTGCAATGTCAACCACCCGGCCACCACCACCAAG---------
rcsp16b_e6.y1       : TCAGGgAGG*GTG*GTGACC*GTGCC*GGCCAGCAGCCTGTCCAGCAAGAGCTACACCTGCAATGTCAACCACCCGGCCACCACCACCAAGG--------
rcly07b_g9.y1       : TCAGC*AGC*ATG*GTGACC*GTGCC*GGCCAGCAGCCTGTCCAGCAAGAGCTACACCTGCAATGTCAACCACCCGGACACCACCACCAAG---------
rcli06b_f3.y1       : TCAGC*AGC*ATG*GTGACC*GTGCC*GGCCAGCAGCCTGTCCAGCAAGAGCTACACCTGCAATGTCAACCACCCGGCCACCACCACCAAGG--------
rcly13b_n20.y1      : TCAGC*AGC*ATG*GTGACC*GTGCC*GGCCAGCAGCCTGTCCAGCAAGAGCTACACCTGCAATGTCAACCACCCGGCCACCACCACCAAGG--------
rpigcb_11807.y1     : TCAGC*AGCgATG*GTGACC*GTGCC*GGCCAGCAGCCTGTCCAGCAAGAGCTACACCTGCAATGTCAACCACCCGGCCACCACCACCAAGGT-------
rcly27b_n14.y1      : TCAGC*AGC*ATG*GTGACC*GTGCC*GGCCAGCAGCCTGTCCAGCAAGAGCTACACCTGCAATGTCAACCACCCGGCCACCACCACCAAGGT-------
rcly09b_h19.y1      : TCAGC*AGC*ATG*GTGACCTGTGCC*GGCCAGCAGCCTGTCCAGCAAGAGCTACACCTGCAATGTCAACCACCCGGCCACCACCACCAAGGTGGACAA-
rcly24b_j21.y1      : TCAGC*AGC*ATG*GTGACC*GTGCC*GGCCAGCAGCCTGTCCAGCAAGAGCTACACCTGCAATGTCAACCACCCGGCCACCACCACCAAGGTGGACA--
rlnt16c_g15.y1      : TCAGC*AGC*ATGtGTGACCTGTGCC*GGCCAGCAGCCTGTCCAGCAAGAGCTACACCTGCAATGTCAACCACCCGGCCACCACCACCAAGGTGGACAAG
rcly07b_o2.y1       : TCAGC*AGC*ATG*GTGACC*GTGCC*GGCCAGCAGCCTGTCCAGCAAGAGCTACACCTGCAATGTCAACCACCCGGCCACCACCACCAAGGTGGACAAG
rcsp21b_b20.y1      : TCAGC*AGC*ATG*GTGACCTGTGCC*GGCCAGCAGCCTGTCCAGCAAGAGCTACACCTGCAATGTCAACCACCCGGCCACCACCACCAAGGTGGACAAG
rcsp26b_c16.y1      : TCAGC*AGC*ATG*GTGACC*GTGCC*GGCCAGCAGCCTGTCCAGCAAGAGCTACACCTGCAATGTCAACCACCCGGCCACCACCACCAAGGTGGACAAG
rcsp33b_m19.y1      : TCAGC*AGC*ATG*GTGACC*GTGCC*GGCCAGCAGCCTGTCGAGCAAGAGCTACACCTGCAATGTCAACCACCCGGCCACCACCACCAAGGTGGACAAG
rcly12b_p7.y1       : TCAGC*AGC*ATG*GTGACCTGTGCCtGGCCAGCAGCCTGTCCAGCAAGAGCTACACCTGCAATGTCAACCACCCGGCCACCACCACCAAGGTGGACAAG
rcly11b_b13.y1      : TCAGC*AGC*ATG*GTGACC*GTGCC*GGCCAGCAGCCTGTTCAGCAAGAGCTACACCTGCAATGTCAACCACCCGGCCACCACCACCAAGGTGGACAAG
rlnt32c_p13.y1      : TCAGC*AGC*ATG*GTGACC*GTGCC*GGCCAGCAGCCTGTCCAGCAAGAGCTACACCTGCAATGTCAACCACCCGGCCACCACCACCAAGGTGGACAAG
rpigcb_13418.y1     : ---GC*AGC*ATG*GTGACC*GTGCC*GGCCAGCAGCCTGTCCAGCAAGAGCTACACCTGCAATGTCAACCACCCGGCCACCACCACCAAGGTGGACAAG
rpigca0_014388.y1   : -------GC*ATG*GTGACC*GTGCC*GGCCAGCAGCCTGTCCAGCAAGAGCTACACCTGCAATGTCAACCACCCGGCCACCACCACCAAGGTGGACAAG
rcly23b_c4.y1       : --------c*gaG*GTGACC*GTGCC*GGCCAGCAGCCTGTCCAGCAAGAGCTACACCTGCAATGTCAACCACCCGGCCACCACCACCAAGGTGGAC---
rcad25b_n8.y1       : ------------G*GTGACC*GTGCC*GGCCAGCAGCCTGTCCAGCAAGAGCTACACCTGCAATGTCAACCACCCGGCCACCACCACCAAGGTGGACAAG
rcbl0_003557.y1     : -----------------------------------------------AGAGCTACACCTGCAATGTCAACCACCCGGCCACCACCACCAAGGTGGACAAG
rcly36b_p24.y1      : -----------------------------------------------AGAGCTACACCTGCAATGTCAACCACCCGGCCACCACCACCAAGGTGGACAAG

----------------------------
BGISUSX0002000544   : CGTGTT
rcad08b_p12.y1      : ------
rcly26b_c17.y1      : ------
rcly20b_f2.y1       : ------
rcsp21b_e9.y1       : ------
rcly09b_p19.y1      : ------
rcsp22b_k10.y1      : ------
rpigcb_2672.y1      : ------
rpigcb_9761.y1      : ------
rcly21b_j14.y1      : ------
rcly21b_n3.y1       : ------
rcbl0_014322.y1     : ------
rcly15b_o1.y1       : ------
rcly06b_i17.y1      : ------
rcly21b_m18.y1      : ------
rpigca0_010741.y1   : ------
rcad09b_p14.y1      : ------
rcly22b_j4.y1       : ------
rcly13b_b20.y1      : ------
rcly06b_p9.y1       : ------
rcly28b_c14.y1      : ------
rcly32b_a13.y1      : ------
rcad06b_o14.y1      : ------
rcly32b_f1.y1       : ------
rcbl0_021288.y1     : ------
rcly34b_g1.y1       : ------
rpigcb_2168.y1      : ------
rcly11b_l8.y1       : ------
rcly21b_o22.y1      : ------
rcsp26b_m24.y1      : ------
rcly25b_e2.y1       : ------
rcsp12b_g16.y1      : ------
rcly26b_o9.y1       : ------
rcly36b_g20.y1      : ------
rcsp24b_b20.y1      : ------
rcad07b_g10.y1      : ------
rcly38b_e4.y1       : ------
rcsp30b_k17.y1      : ------
rcsp24b_d19.y1      : ------
rcly10b_g6.y1       : ------
rcsp37b_f6.y1       : ------
rcly22b_o4.y1       : ------
rcly38b_n6.y1       : ------
rcly30b_l20.y1      : ------
rcly34b_f3.y1       : ------
rcad13b_m19.y1      : ------
rcsp18b_k7.y1       : ------
rcly28b_c11.y1      : ------
rcsp16b_e6.y1       : ------
rcly07b_g9.y1       : ------
rcli06b_f3.y1       : ------
rcly13b_n20.y1      : ------
rpigcb_11807.y1     : ------
rcly27b_n14.y1      : ------
rcly09b_h19.y1      : ------
rcly24b_j21.y1      : ------
rlnt16c_g15.y1      : CG----
rcly07b_o2.y1       : ------
rcsp21b_b20.y1      : CG----
rcsp26b_c16.y1      : C-----
rcsp33b_m19.y1      : C-----
rcly12b_p7.y1       : CGTG--
rcly11b_b13.y1      : CG----
rlnt32c_p13.y1      : CG----
rpigcb_13418.y1     : CGT---
rpigca0_014388.y1   : CGTG--
rcly23b_c4.y1       : ------
rcad25b_n8.y1       : CGTGT-
rcbl0_003557.y1     : CGTGTt
rcly36b_p24.y1      : CGTGTt

Cited by

ENST00000251006