Sequences
rcad17b_n6.y1 +
rcad21b_p24.y1 +
rcad20b_b23.y1 +
rcbl0_020694.y1 +
rcbl0_014322.y1 +
rcsp24b_g24.y1 +
rcly10b_g6.y1 +
rcbl0_022792.y1 +
rcsp28b_i10.y1 +
rcsp24b_d19.y1 +
rcad06b_i24.y1 +
rcad02b_b22.y1 +
rcly11b_g5.y1 +
rcad05b_k22.y1 +
rcad13b_m19.y1 +
rcly07b_f8.y1 +
rcly34b_g1.y1 +
rcly15b_o1.y1 +
rcly35b_b7.y1 +
rpigcb_9166.y1 +
rcly22b_g4.y1 +
rcly30b_e21.y1 +
rcly32b_h3.y1 +
rpigfat_7163.y1 +
rcly27b_p19.y1 +
rpigcb_11807.y1 +
rpigcb_16924.y1 +
rcly39b_p3.y1 +
rpigcb_15369.y1 +
rcly38b_o24.y1 +
rcbl0_007605.y1 +
rcad23b_h20.y1 +
rcsp06b_g12.y1 +
rcly28b_m21.y1 +
rpigcb_11342.y1 +
rcly16b_n1.y1 +
rcsp36b_j14.y1 +
rcsp28b_m4.y1 +
rpigcb_13418.y1 +
rcsp26b_m24.y1 +
rcly18b_e15.y1 +
rcly12b_p7.y1 +
rcsp30b_k17.y1 +
rcad17b_g12.y1 +
rcly34b_f3.y1 +
rpigcb_1324.y1 -
rcsp21b_b20.y1 +
rcly26b_p17.y1 +
rcly13b_i2.y1 +
rlnt21c_d16.y1 +
rcly16b_p4.y1 +
rpigcb_14348.y1 +
rcad28b_k21.y1 +
rcov32b_h15.y1 +
rpigcb_8386.y1 +
rcly31b_c10.y1 +
rcly35b_i5.y1 +
rlnt02c_b24.y1 +
rcly26b_o9.y1 +
rpigca0_006920.y1 +
rlnt31c_n18.y1 +
rcly30b_d15.y1 +
rcli06b_f3.y1 +
rcsp12b_g16.y1 +
rcad35b_k21.y1 +
rpigcb_15563.y1 +
rpigcb_8279.y1 +
rcly18b_k11.y1 +
rcad31b_a13.y1 +
rcad24b_p16.y1 +
rcly17b_o1.y1 +
rcly36b_f24.y1 +
rcly27b_b14.y1 +
rcly11b_c9.y1 +
rcsp02b_g20.y1 +
rcly06b_h14.y1 +
rcly18b_e5.y1 +
rcly32b_d18.y1 +
rcly37b_b8.y1 +
rcly06b_d7.y1 +
rcad22b_o19.y1 +
rcly40b_n5.y1 +
rcly11b_n10.y1 +
rpigcb_14123.y1 +
rcly31b_b13.y1 +
rcly07b_l10.y1 +
rcad14b_h20.y1 +
rpigcb_2751.y1 +
rcly39b_a18.y1 +
rcly09b_l2.y1 +
rcly17b_i20.y1 +
rcly20b_c2.y1 +
rcad22b_i10.y1 +
rcly26b_g14.y1 +
rcbl0_008480.y1 +
rcad15b_k7.y1 +
rcad22b_i2.y1 +
rcly23b_k12.y1 +
rcsp34b_b12.y1 +
rcad28b_j9.y1 +
rcad34b_k13.y1 +
rcly29b_e22.y1 +
rcly37b_n13.y1 +
rcly14b_k15.y1 +
rcly25b_n19.y1 +
rcad23b_a7.y1 +
rpigcb_8362.y1 +
rcsp34b_o1.y1 +
rcad10b_i18.y1 +
rpigcb_15128.y1 +
rcsp27b_e14.y1 +
rcsp35b_p19.y1 +
rcly06b_g12.y1 +
rcsp27b_g7.y1 +
rcad14b_g9.y1 +
rcje31_o17.y1 -
rcsp22b_c19.y1 +
rcsp18b_a10.y1 +
rlnt14c_m11.y1 +
rcly07b_m22.y1 +
rcly14b_g19.y1 +
rcly37b_j8.y1 -
rcsp24b_f18.y1 +
rcad32b_n20.y1 +
rcad09b_n19.y1 +
rmcp17c_j21.y1 +

BGISUSX0002000550

Source Seq Type : est

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>BGISUSX0002000550
AGGGCCCTCGGTCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACACCCCAGGTCACGTGCGTGGTAGTTGATGTGAGCCAGGAG
AACCCGGAGGTCCAGTTCTCCTGGTACGTGGACGGCGTAGAGGTGCACACGGCCCAGACGAGGCCAAAGGAGGAGCAGTTCAACAGCACCTACCGCGTGG
TCAGCGTCCTGCCCATCCAGCACCAGGACTGGCTGAACGGGAAGGAGTTCAAGTGCAAGGTCAACAACAAAGACCTCCCAGCCCCCATCACAAGGATCAT
CTCCAAGGCCAAA

Assemble


--------------------------------------------------------------------------------------------------------------------------
BGISUSX0002000550   : AGGGCCCTCG*G*TCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACACCCCAG*GTCAC*GTG*C*GTG*GTAGTTGATGTGAG
rcad17b_n6.y1       : AGGGCCCTCG*G*TCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACACCCCAG*GTCAC*GTG*C*GTG*GTAGTTGATGTGAG
rcad21b_p24.y1      : AGGGCCCTCG*G*TCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACACCCCAG*GTCAC*GTG*C*GTG*GTAGTTGATGTGAG
rcad20b_b23.y1      : AGGGCCCTCGaG*TCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACACCCCAG*GTCAC*GTG*C*GTG*GTAGTTGATGTGAG
rcbl0_020694.y1     : AGGGCCCTCG*G*TCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACACCCCAG*GTCAC*GTGnC*GTG*GTAGTTGATGTGAG
rcbl0_014322.y1     : AGGGCCCTCG*GaTCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACACCCCAG*GTCAC*GTG*C*GTG*GTAGTTGATGTGAG
rcsp24b_g24.y1      : AGGGCCCTCG*G*TCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACACCCCAG*GTCAC*GTG*C*GTG*GTAGTTGATGTGAG
rcly10b_g6.y1       : AGGGCCCTCG*G*TCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACACCCCAG*GTCAC*GTG*C*GTG*GTAGTTGATGTGAG
rcbl0_022792.y1     : AGGGCCCTCG*G*TCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACACCCCAG*GTCAC*GTG*C*GTG*GTAGTTGATGTGAG
rcsp28b_i10.y1      : AGGGCCCTCG*G*TCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACACCCCAG*GTCAC*GTG*C*GTG*GTAGTTGATGTGAG
rcsp24b_d19.y1      : AGGGCCCTCG*G*TCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACACCCCAG*GTCAC*GTG*C*GTG*GTAGTTGATGTGAG
rcad06b_i24.y1      : agTGCCCTCG*G*TCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACACCCCAG*GTCAC*GTG*C*GTG*GTAGTTGATGTGAG
rcad02b_b22.y1      : AGGGCCCTCG*G*TCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACACCCCAG*GTCAC*GTG*C*GTG*GTAGTTGATGTGAG
rcly11b_g5.y1       : AGGGCCCTCG*G*TCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACACCCCAG*GTCAC*GTG*C*GTG*GTAGTTGATGTGAG
rcad05b_k22.y1      : AGGGCCCTCG*G*TCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACACCCCAG*GTCAC*GTG*C*GTG*GTAGTTGATGTGAG
rcad13b_m19.y1      : agTGCCCTCG*G*TCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACACCCCAG*GTCAC*GTG*C*GTG*GTAGTTGATGTGAG
rcly07b_f8.y1       : AGGGCCCTCG*G*TCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACACCCCAG*GTCAC*GTG*C*GTG*GTAGTTGATGTGAG
rcly34b_g1.y1       : AGGGCCCTCG*G*TCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACACCCCAG*GTCAC*GTG*C*GTG*GTAGTTGATGTGAG
rcly15b_o1.y1       : AGGGCCCTCG*G*TCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACACCCCAG*GTCAC*GTG*C*GTG*GTAGTTGATGTGAG
rcly35b_b7.y1       : AGGGCCCTCG*G*TCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACACCCCAG*GTCAC*GTG*C*GTG*GTAGTTGATGTGAG
rpigcb_9166.y1      : AGGGCCCTCG*G*TCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACACCCCAG*GTCAC*GTG*C*GTG*GTAGTTGATGTGAG
rcly22b_g4.y1       : AGGGCCCTCG*G*TCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACACCCCAG*GTCAC*GTG*C*GTG*GTAGTTGATGTGAG
rcly30b_e21.y1      : AGGGCCCTCG*G*TCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACACCCCAG*GTCAC*GTG*C*GTG*GTAGTTGATGTG--
rcly32b_h3.y1       : AGGGCCCTCG*G*TCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACACCCCAG*GTCAC*GTG*C*------------------
rpigfat_7163.y1     : agTGCCCTCG*G*TCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACACCCCAG*GTCAC*GTG*C*GTG*GTGGTTGATGTGAG
rcly27b_p19.y1      : AGGGCCCTCG*G*TCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACACCCCAG*GTCAC*GTG*C*GTG*GTAGTTGATGTGAG
rpigcb_11807.y1     : AGGGCCCTCG*G*TCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACACCCCAG*GTCAC*GTG*C*GTG*GTAGTTGATGTGAG
rpigcb_16924.y1     : AGGGCCCTCG*G*TCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACACCCCAG*GTCAC*GTG*C*GTG*GTAGTTGATGTGAG
rcly39b_p3.y1       : agTGCCCTCG*G*TCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACACCCCAG*GTCAC*GTG*C*GTG*GTAGTTGATGTGAG
rpigcb_15369.y1     : AGGGCCCTCG*G*TCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACACCCCAG*GTCAC*GTG*C*GTG*GTAGTTGATGTGAG
rcly38b_o24.y1      : AGGGCCCTCG*G*TCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGAGACCCCAG*GTCAC*GTG*C*GTG*GTAGTTGATGTGAG
rcbl0_007605.y1     : AGGGCCCTCG*G*TCTTCATCTTCCCTCCAAAAGCCAAGGACACCCTCATGATCTCCCGGACACCCCAG*GTCAC*GTG*C*GTG*GTAGTTGATGTGAG
rcad23b_h20.y1      : AGGGCCCTCG*G*TCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACACCCCAG*GTCAC*GTG*C*GTG*GTAGTTGATGTGAG
rcsp06b_g12.y1      : agTGCCCTCG*G*TCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACACCCCAG*GTCAG*GTG*C*GTG*GTAGTTGATGTGAG
rcly28b_m21.y1      : AGGGCCCTCG*G*TCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACACCCCAG*GTCAG*GTG*C*GTG*GTAGTTGATGTGAG
rpigcb_11342.y1     : AGGGCCCTCG*G*TCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACACCCCAG*GTCAC*GTG*C*GTG*GTAGTTGATGTGAG
rcly16b_n1.y1       : AGGGCCCTCG*G*TCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACACCCCAG*GTCAC*GTG*C*GTG*GTAGTTGATGTGAG
rcsp36b_j14.y1      : AGGGCCCTCG*G*TCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACACCCCAG*GTCAC*GTG*C*GTG*GTAGTTGATGTGAG
rcsp28b_m4.y1       : AGGGCCCTCG*G*TCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACACCCCAG*GTCAC*GTG*C*GTG*GTAGTTGATGTGAG
rpigcb_13418.y1     : AGGGCCCTCG*G*TCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACACCCCAG*GTCAC*GTG*C*GTG*GTAGTTGATGTGAG
rcsp26b_m24.y1      : AGGGCCCTCG*G*TCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACACCCCAG*GTCAC*GTG*C*GTG*GTAGTTGATGTGAG
rcly18b_e15.y1      : AGGGCCCTCG*G*TCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACACCCCAG*GTCAC*GTG*C*GTG*GTAGTTGATGTGAG
rcly12b_p7.y1       : AGGGCCCTCG*G*TCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACACCCCAG*GTCAC*GTG*C*GTG*GTAGTTGATGTGAG
rcsp30b_k17.y1      : AGGGCCCTCG*G*TCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACACCCCAG*GTCAC*GTG*C*GTG*GTAGTTGATGTGAG
rcad17b_g12.y1      : AGGGCCCTCG*G*TCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACACCCCAG*GTCAC*GTG*C*GTG*GTAGTTGATGTGAG
rcly34b_f3.y1       : AGGGCCCTCG*G*TCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACACCCCAG*GTCAC*GTG*C*GTG*GTAGTTGATGTGAG
rpigcb_1324.y1      : AGGGCCCTCG*G*TCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACACCTCAG*GTCAC*GTG*C*GTG*GTAGTTGATGTGAG
rcsp21b_b20.y1      : AGGGCCCTCG*G*TCTTCATCTTCCCTCCAAAAGCCAAGGACACCCTCATGATCTCCCGGACACCCCAG*GTCAC*GTG*C*GTG*GTAGTTGATGTGAG
rcly26b_p17.y1      : -GGGCCCTCG*G*CCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACCCCCAAG*GTCAC*GTG*C*GTG*GTGGTAGATGTGAG
rcly13b_i2.y1       : -GGGCCCTCG*G*CCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACCCCCAAG*GTCAC*GTG*C*GTG*GTGGTAGATGTGAG
rlnt21c_d16.y1      : -GGGCCCTCG*G*CCTTCATCTTCCCTCCAAAACCCAGGGACACCCTCATGATCTCCCGGACCCCCAAG*GTCAC*GTG*C*GTG*GTGGTAGATGTGAG
rcly16b_p4.y1       : -GGGCCCTCG*G*CCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACCCCCGAG*GTCAC*GTG*C*GTG*GCGGTACATGTGAG
rpigcb_14348.y1     : -GGGCCCTCG*G*CCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACCCCCAAG*GTCAC*GTG*C*GTG*GTGGTAGATGTGAG
rcad28b_k21.y1      : -GGGCCCTCG*G*CCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACCCCCAAG*GTCAC*GTG*C*GTG*GTGGTAGATGTGAG
rcov32b_h15.y1      : -GGGCCCTCG*G*CCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACCCCCAAG*GTCAC*GTG*C*GTG*GTGGTAGATGTGAG
rpigcb_8386.y1      : -GGGCCCTCG*G*CCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACCCCCAAG*GTCAC*GTG*C*GTG*GTGGTAGATGTGAG
rcly31b_c10.y1      : -GGGCCCTCG*G*CCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACCCCCAAG*GTCAC*GTG*C*GTG*GTGGTAGATGTGAG
rcly35b_i5.y1       : -GGGCCCTCG*G*CCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACCCCCAAG*GTCAC*GTG*C*GTG*GTGGTAGATGTGAG
rlnt02c_b24.y1      : -GGGCCCTCG*G*CCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACCCCCAAG*GTCAC*GTG*C*GTG*GTGGTAGATGTGAG
rcly26b_o9.y1       : -GGGCCCTCG*G*CCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACCCCCAAG*GTCAC*GTG*C*GTG*GTGGTAGATGTGAG
rpigca0_006920.y1   : -GGGCCCTCG*G*CCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACCCCCAAA*GTCAC*GTG*C*GTG*GTGGTTGATGTGAG
rlnt31c_n18.y1      : -GGGCCCTCG*G*CCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACCCCCAAG*GTCAC*GTG*C*GTG*GTGGTAGATGTGAG
rcly30b_d15.y1      : -GGGCCCTCG*G*CCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACCCCCAAG*GTCGC*GTG*C*GTG*GTGGTAGATGTGAG
rcli06b_f3.y1       : -GGGCCCTCG*G*CCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACCCCCAAG*GTCAC*GTG*C*GTG*GTGGTAGATGTGAG
rcsp12b_g16.y1      : -GGGCCCTCG*G*CCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACCCCCAAG*GTCAC*GTG*C*GTG*GTGGTAGATGTGAG
rcad35b_k21.y1      : -GGGCCCTCG*G*CCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACCCCCAAG*GTCAC*GTG*C*GTG*GTGGTTGATGTGAG
rpigcb_15563.y1     : -GGGCCCTCG*G*CCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACCCCCAAG*GTCAC*GTG*C*GTG*GTGGTAGATGTGAG
rpigcb_8279.y1      : -GGGCCCTCG*G*CCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACCCCCAAG*GTCAC*GTG*C*GTG*GTGGTAGATGTGAG
rcly18b_k11.y1      : --GGCCCTCG*G*TCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACACCCCAG*GTCAC*GTG*C*GTG*GTAGTTGATGTGAG
rcad31b_a13.y1      : --GGCCCTCG*G*TCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACACCCCAG*GTCAC*GTG*C*GTG*GTAGTTGATGTGAG
rcad24b_p16.y1      : --GGCCCTCG*G*TCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACACCCCAG*GTCAC*GTG*C*GTG*GTAGTTGATGTGAG
rcly17b_o1.y1       : -------TCG*G*TCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACACCCCAG*GTCAC*GTG*C*GTG*GTAGTTGATGTGAG
rcly36b_f24.y1      : -------TCG*G*TCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACACCCCAG*GTCAC*GTG*C*GTG*GTAGTTGATGTGAG
rcly27b_b14.y1      : ---------a*g*gcTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACCCCCAAG*GTCAC*GTG*C*GTG*GTGGTAGATGTGAG
rcly11b_c9.y1       : -----------G*TCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACACCCCAG*GTCAC*GTG*C*GTG*GTAGTTGATGTGAG
rcsp02b_g20.y1      : -----------G*TCTTCATCTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACACCCCAG*GTCAC*GTG*C*GTG*GTAGTTGATGTGAG
rcly06b_h14.y1      : --------------------CTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACCCCCAAG*GTCAC*GTG*C*GTG*GTGGTAGATGTGAG
rcly18b_e5.y1       : --------------------CTTCCCTCCAAAACCCAAGGACACCCTCATGATCTCCCGGACACCCCAG*GTCAC*GTG*C*GTG*GTAGTTGATGTGAG
rcly32b_d18.y1      : -----------------------------AAAACCCAAGGACACCCTCATGATCTCCCGGACAGCCCAG*GTCAC*GTG*C*GTG*GTAGTTGATGTGAG
rcly37b_b8.y1       : --------------------------------------GGACACCCTCATGATCTCCCGGACACCCCAGtGTCAC*GTG*C*GTG*GTAGTTGATGTGAG
rcly06b_d7.y1       : --------------------------------------GGACACCCTCATGATCTCCCGGACACCCCAG*GTCACtGTG*CtGTG*GTAGTTGATGTGAG
rcad22b_o19.y1      : ------------------------------------aGGGACACCCTCATGATCTCCCGGACACCCCAG*GTCAC*GTG*C*GTG*GTAGTTGATGTGAG
rcly40b_n5.y1       : ---------------------------------------gagGCCCTCATGATCTCCCGGACACCCCAG*GTCAC*GTG*C*GTG*GTAGTTGATGTGAG
rcly11b_n10.y1      : ---------------------------------------gagGCCCTCATGATCTCCCGGACACCCCAG*GTCAC*GTG*C*GTG*GTAGTTGATGTGAG
rpigcb_14123.y1     : -------------------------------------------CCCTCATGATCTCCCGGACACCCCAG*GTCAC*GTG*C*GTG*GTAGTTGATGTGAG
rcly31b_b13.y1      : ------------------------------------------------ATGATCTCCCGGACCCCCAAG*GTCAC*GTG*C*GTG*GTGGTAGATGTGAG
rcly07b_l10.y1      : --------------------------------------------------GATCTCCCGGACCCCCAAG*GTCAC*GTG*C*GTG*GTGGTAGATGTGAG
rcad14b_h20.y1      : -------------------------------------------------------CCCGGACACCCCAG*GTCAC*GTG*C*GTG*GTAGTTGATGTGAG
rpigcb_2751.y1      : ---------------------------------------------------------------CCCCAG*GTCAC*GTG*C*GTG*GTAGTTGATGTGAG
rcly39b_a18.y1      : ------------------------------------------------------------------gag*ggtAC*GTG*C*GTT*GTGGTAGATGTGAG
rcly09b_l2.y1       : ----------------------------------------------------------------------GTCAC*GTG*C*GTGtGTAGTTGATGTGAG
rcly17b_i20.y1      : -------------------------------------------------------------------AG*GTCAC*GTG*C*GTG*GTAGTTGATGTGAG
rcly20b_c2.y1       : --------------------------------------------------------------------G*GTCAC*GTG*C*GTG*GTGGTAGATGTGAG
rcad22b_i10.y1      : ------------------------------------------------------------------------CAC*GAG*G*GTG*GTAGTTGATGTGAG
rcly26b_g14.y1      : ----------------------------------------------------------------------------------GTG*GTTGTAGATGTGAG
rcbl0_008480.y1     : -----------------------------------------------------------------------------------------GTTGATGTGAG
rcad15b_k7.y1       : -----------------------------------------------------------------------------------------------GTGAG
rcad22b_i2.y1       : -----------------------------------------------------------------------------------------------GTGAG
rcly23b_k12.y1      : ---------------------------------------------------------------------------------------------------G
rcsp34b_b12.y1      : ----------------------------------------------------------------------------------------------------
rcad28b_j9.y1       : ----------------------------------------------------------------------------------------------------
rcad34b_k13.y1      : ----------------------------------------------------------------------------------------------------
rcly29b_e22.y1      : ----------------------------------------------------------------------------------------------------
rcly37b_n13.y1      : ----------------------------------------------------------------------------------------------------
rcly14b_k15.y1      : ----------------------------------------------------------------------------------------------------
rcly25b_n19.y1      : ----------------------------------------------------------------------------------------------------
rcad23b_a7.y1       : ----------------------------------------------------------------------------------------------------
rpigcb_8362.y1      : ----------------------------------------------------------------------------------------------------
rcsp34b_o1.y1       : ----------------------------------------------------------------------------------------------------
rcad10b_i18.y1      : ----------------------------------------------------------------------------------------------------
rpigcb_15128.y1     : ----------------------------------------------------------------------------------------------------
rcsp27b_e14.y1      : ----------------------------------------------------------------------------------------------------
rcsp35b_p19.y1      : ----------------------------------------------------------------------------------------------------
rcly06b_g12.y1      : ----------------------------------------------------------------------------------------------------
rcsp27b_g7.y1       : ----------------------------------------------------------------------------------------------------
rcad14b_g9.y1       : ----------------------------------------------------------------------------------------------------
rcje31_o17.y1       : ----------------------------------------------------------------------------------------------------
rcsp22b_c19.y1      : ----------------------------------------------------------------------------------------------------
rcsp18b_a10.y1      : ----------------------------------------------------------------------------------------------------
rlnt14c_m11.y1      : ----------------------------------------------------------------------------------------------------
rcly07b_m22.y1      : ----------------------------------------------------------------------------------------------------
rcly14b_g19.y1      : ----------------------------------------------------------------------------------------------------
rcly37b_j8.y1       : ----------------------------------------------------------------------------------------------------
rcsp24b_f18.y1      : ----------------------------------------------------------------------------------------------------
rcad32b_n20.y1      : ----------------------------------------------------------------------------------------------------
rcad09b_n19.y1      : ----------------------------------------------------------------------------------------------------
rmcp17c_j21.y1      : ----------------------------------------------------------------------------------------------------

--------------------------------------------------------------------------------------------------------------------------
BGISUSX0002000550   : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rcad17b_n6.y1       : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGACtG*GCTGTAGA*G*GTGCACACtGtGCCC*AGACGAGGCCAAAGGAGtGAGCAGCT
rcad21b_p24.y1      : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGACtG*GC*GTAGA*GtGTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rcad20b_b23.y1      : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rcbl0_020694.y1     : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rcbl0_014322.y1     : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rcsp24b_g24.y1      : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rcly10b_g6.y1       : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG---------
rcbl0_022792.y1     : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTACA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rcsp28b_i10.y1      : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rcsp24b_d19.y1      : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rcad06b_i24.y1      : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rcad02b_b22.y1      : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rcly11b_g5.y1       : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rcad05b_k22.y1      : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rcad13b_m19.y1      : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGATGCCAAAGGAG*GAGCAGTT
rcly07b_f8.y1       : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rcly34b_g1.y1       : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*---------------------------------
rcly15b_o1.y1       : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTG--------------------------------------------------------------------
rcly35b_b7.y1       : CCAG*GAGAACCC*GGAGGTCCAGTTCTC-----------------------------------------------------------------------
rpigcb_9166.y1      : CCAG*GAGAACCC*GGAGGTCCAGTTCTCC----------------------------------------------------------------------
rcly22b_g4.y1       : C---------------------------------------------------------------------------------------------------
rcly30b_e21.y1      : ----------------------------------------------------------------------------------------------------
rcly32b_h3.y1       : ----------------------------------------------------------------------------------------------------
rpigfat_7163.y1     : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*AC--------------------------------------------------------------
rcly27b_p19.y1      : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GGCC*AGACGAGGCCAAAGGAG*GAGC----
rpigcb_11807.y1     : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*G-------------------------------------------------
rpigcb_16924.y1     : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC--------------------------------------------------------
rcly39b_p3.y1       : CCAG*GAGAACCC*GGAGGTCCAGTACTCCTGG*T*ACGTGGAC*G*-----------------------------------------------------
rpigcb_15369.y1     : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGT------------------------------------------------------------
rcly38b_o24.y1      : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*----------------------------------------------------------------
rcbl0_007605.y1     : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*--------------------------------------------
rcad23b_h20.y1      : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rcsp06b_g12.y1      : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rcly28b_m21.y1      : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rpigcb_11342.y1     : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rcly16b_n1.y1       : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGCT
rcsp36b_j14.y1      : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*TtACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rcsp28b_m4.y1       : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rpigcb_13418.y1     : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rcsp26b_m24.y1      : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAAA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rcly18b_e15.y1      : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rcly12b_p7.y1       : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAAA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rcsp30b_k17.y1      : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTACA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rcad17b_g12.y1      : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rcly34b_f3.y1       : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rpigcb_1324.y1      : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rcsp21b_b20.y1      : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAAA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rcly26b_p17.y1      : CCAG*-----------------------------------------------------------------------------------------------
rcly13b_i2.y1       : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rlnt21c_d16.y1      : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rcly16b_p4.y1       : CCAG*GAGAACCC---------------------------------------------------------------------------------------
rpigcb_14348.y1     : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*AC--------------------------------------------------------------
rcad28b_k21.y1      : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rcov32b_h15.y1      : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rpigcb_8386.y1      : C---------------------------------------------------------------------------------------------------
rcly31b_c10.y1      : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rcly35b_i5.y1       : CCAG*GAGAACCC*GGATGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rlnt02c_b24.y1      : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rcly26b_o9.y1       : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rpigca0_006920.y1   : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*G----------------------------------------------------
rlnt31c_n18.y1      : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rcly30b_d15.y1      : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rcli06b_f3.y1       : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC----------------------------------
rcsp12b_g16.y1      : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rcad35b_k21.y1      : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rpigcb_15563.y1     : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rpigcb_8279.y1      : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rcly18b_k11.y1      : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rcad31b_a13.y1      : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCG*AGACGAGGCCAAAGGAG*GAGCAGTT
rcad24b_p16.y1      : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACCAGGCCAAAGGAG*GAGCAGTT
rcly17b_o1.y1       : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rcly36b_f24.y1      : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rcly27b_b14.y1      : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GGGGAAAG*G*GCCC*AAACGAGGCCAAAGGAG*GAGCAGTT
rcly11b_c9.y1       : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rcsp02b_g20.y1      : CCAG*GAGAACCC*GGAGGTCCAGGGGTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*ATACGAGGCCAAAGGAG*GAGCAGTT
rcly06b_h14.y1      : CCAGtGAGAACCCtGGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rcly18b_e5.y1       : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rcly32b_d18.y1      : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rcly37b_b8.y1       : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rcly06b_d7.y1       : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rcad22b_o19.y1      : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rcly40b_n5.y1       : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*TtACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rcly11b_n10.y1      : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rpigcb_14123.y1     : CCAT*GAGAACCC*GGAGGTCCAGTTCTCCTGC*T*ACGTG-----------------------------------------------------------
rcly31b_b13.y1      : CCAG*GAGAGCCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rcly07b_l10.y1      : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rcad14b_h20.y1      : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rpigcb_2751.y1      : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rcly39b_a18.y1      : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACACTG*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rcly09b_l2.y1       : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTACA*GtGTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rcly17b_i20.y1      : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rcly20b_c2.y1       : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rcad22b_i10.y1      : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rcly26b_g14.y1      : CCAG*GAGAACCCtGGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GCtGTAGA*G*GTGCACACTG*GCCC*AGACGAGGCCAAAGGAGtGAGCAGTT
rcbl0_008480.y1     : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGGcT*ACGTGGAC*G*GC*GTACA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rcad15b_k7.y1       : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*GtGT*GTAGAtGtGTGCACAC*G*GCCTgAGACGAGGCCAAAGGAGtGAGCAGTT
rcad22b_i2.y1       : CCAG*GAGAACCC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rcly23b_k12.y1      : CCAG*GAGAACCC*GGAGGT*CAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rcsp34b_b12.y1      : -------agGCCC*GGAGGT*CAGTTCTCCTGGtT*ACGTGGAC*G*GCtGTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rcad28b_j9.y1       : -----------CC*GGAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTTAA*GcGTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rcad34b_k13.y1      : ------------C*GGAGGT*CAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rcly29b_e22.y1      : ---------------GAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rcly37b_n13.y1      : ---------------GAGGTCCAGTTCTCCTGG*T*ACGTGGAC*G*GC*GTAGA*T*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rcly14b_k15.y1      : ------------------------------TGG*T*ACGTGGAC*G*GC*GTAGA*G*GTGCACACTG*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rcly25b_n19.y1      : --------------------------------g*g*cacgaggc*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rcad23b_a7.y1       : ----------------------------------------GGAC*G*GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rpigcb_8362.y1      : -----------------------------------------------GC*GTAGA*G*GTGCACAC*G*GCCC*AGACGAGGCCAAAGGAGtGAGCAGTT
rcsp34b_o1.y1       : -----------------------------------------------------gg*G*GTGCACACTG*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rcad10b_i18.y1      : ------------------------------------------------------------gcacga*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rpigcb_15128.y1     : ------------------------------------------------------------GCACAC*G*GCCC*AGACGAGGCCAAAGGAG*GAGCAGTT
rcsp27b_e14.y1      : ---------------------------------------------------------------------------------GCCAAAGGAG*GAGCAGTT
rcsp35b_p19.y1      : ------------------------------------------------------------------------------------gcaCGAG*GAGCAGTT
rcly06b_g12.y1      : -------------------------------------------------------------------------------------cggcac*gaggtGTT
rcsp27b_g7.y1       : -------------------------------------------------------------------------------------------------GTT
rcad14b_g9.y1       : ----------------------------------------------------------------------------------------------------
rcje31_o17.y1       : ----------------------------------------------------------------------------------------------------
rcsp22b_c19.y1      : ----------------------------------------------------------------------------------------------------
rcsp18b_a10.y1      : ----------------------------------------------------------------------------------------------------
rlnt14c_m11.y1      : ----------------------------------------------------------------------------------------------------
rcly07b_m22.y1      : ----------------------------------------------------------------------------------------------------
rcly14b_g19.y1      : ----------------------------------------------------------------------------------------------------
rcly37b_j8.y1       : ----------------------------------------------------------------------------------------------------
rcsp24b_f18.y1      : ----------------------------------------------------------------------------------------------------
rcad32b_n20.y1      : ----------------------------------------------------------------------------------------------------
rcad09b_n19.y1      : ----------------------------------------------------------------------------------------------------
rmcp17c_j21.y1      : ----------------------------------------------------------------------------------------------------

--------------------------------------------------------------------------------------------------------------------------
BGISUSX0002000550   : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*GGTCAACAA
rcad17b_n6.y1       : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*G-------------
rcad21b_p24.y1      : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*GGTCAACAA
rcad20b_b23.y1      : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*GGTCAACAA
rcbl0_020694.y1     : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGGcAAGGAGTCcAA*GcT*GCAA*GGTCAACAA
rcbl0_014322.y1     : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*G--------
rcsp24b_g24.y1      : *CAACA*GCACC----------------------------------------------------------------------------------------
rcly10b_g6.y1       : ----------------------------------------------------------------------------------------------------
rcbl0_022792.y1     : *CAACA*GCACC----------------------------------------------------------------------------------------
rcsp28b_i10.y1      : *---------------------------------------------------------------------------------------------------
rcsp24b_d19.y1      : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACT-------------------------------------------
rcad06b_i24.y1      : *CAACA*GCACCTACC*GC*GTG*GTCAGC*G--------------------------------------------------------------------
rcad02b_b22.y1      : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCA-------------------------------------------------------
rcly11b_g5.y1       : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACC--------------------------------------------------
rcad05b_k22.y1      : *CAACA*GCACCTACC*GA*GTG*GTCAGC*GTCCTGCCCAT----------------------------------------------------------
rcad13b_m19.y1      : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCAT----------------------------------------------------------
rcly07b_f8.y1       : *CAACA*GCACCTACC*GC*GTG*GT--------------------------------------------------------------------------
rcly34b_g1.y1       : ----------------------------------------------------------------------------------------------------
rcly15b_o1.y1       : ----------------------------------------------------------------------------------------------------
rcly35b_b7.y1       : ----------------------------------------------------------------------------------------------------
rpigcb_9166.y1      : ----------------------------------------------------------------------------------------------------
rcly22b_g4.y1       : ----------------------------------------------------------------------------------------------------
rcly30b_e21.y1      : ----------------------------------------------------------------------------------------------------
rcly32b_h3.y1       : ----------------------------------------------------------------------------------------------------
rpigfat_7163.y1     : ----------------------------------------------------------------------------------------------------
rcly27b_p19.y1      : ----------------------------------------------------------------------------------------------------
rpigcb_11807.y1     : ----------------------------------------------------------------------------------------------------
rpigcb_16924.y1     : ----------------------------------------------------------------------------------------------------
rcly39b_p3.y1       : ----------------------------------------------------------------------------------------------------
rpigcb_15369.y1     : ----------------------------------------------------------------------------------------------------
rcly38b_o24.y1      : ----------------------------------------------------------------------------------------------------
rcbl0_007605.y1     : ----------------------------------------------------------------------------------------------------
rcad23b_h20.y1      : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*---------
rcsp06b_g12.y1      : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*GGTCAACAA
rcly28b_m21.y1      : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*GGTCAACAA
rpigcb_11342.y1     : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*------------------
rcly16b_n1.y1       : aCAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTAcAA*G*T*GCAA*G--------
rcsp36b_j14.y1      : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*GGTCAACAA
rcsp28b_m4.y1       : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTAcAA*G*T*GCAA*GGTCAACAA
rpigcb_13418.y1     : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*GGTCAACAA
rcsp26b_m24.y1      : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*ACGGAGTTCAA*G*T*GCAA*GGTCAACAA
rcly18b_e15.y1      : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*GGTCAACAA
rcly12b_p7.y1       : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*GGTCAACAA
rcsp30b_k17.y1      : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*GGTCAACAA
rcad17b_g12.y1      : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*GGTCAACAA
rcly34b_f3.y1       : *CAATA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAG---------------------------
rpigcb_1324.y1      : *CAACA*GCACATACC*GC*GTG*GTCAGC*GTCATGCCCATCCAGCACCAG*GACTG*CTGAAC*GGG*AAGGAGTT*AA*G-----------------
rcsp21b_b20.y1      : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTAcAA*G*TaGcAA*G--------
rcly26b_p17.y1      : ----------------------------------------------------------------------------------------------------
rcly13b_i2.y1       : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*GGTCAACAA
rlnt21c_d16.y1      : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*GGTCAACAA
rcly16b_p4.y1       : ----------------------------------------------------------------------------------------------------
rpigcb_14348.y1     : ----------------------------------------------------------------------------------------------------
rcad28b_k21.y1      : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*GGTCAACAA
rcov32b_h15.y1      : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*GGTCAACAA
rpigcb_8386.y1      : ----------------------------------------------------------------------------------------------------
rcly31b_c10.y1      : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTCCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*GGTCAACAA
rcly35b_i5.y1       : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*GGTCAACAA
rlnt02c_b24.y1      : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*GGTCAACAA
rcly26b_o9.y1       : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCC-----------------------------------------------------------------
rpigca0_006920.y1   : ----------------------------------------------------------------------------------------------------
rlnt31c_n18.y1      : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGC-----------------------------------------------------
rcly30b_d15.y1      : *CAACA*GCACC----------------------------------------------------------------------------------------
rcli06b_f3.y1       : ----------------------------------------------------------------------------------------------------
rcsp12b_g16.y1      : *CAACA*GCACCTACC*GC*GTG*GT--------------------------------------------------------------------------
rcad35b_k21.y1      : *CAACA*GCACCTACC*GT*GTG*GTCAGC*GTCCTGCCCATCCAGCACGAG*GACTGGCTGAAG*GGG*AAGGAGTTcGA*G*T*GCAA*GGTCAACAA
rpigcb_15563.y1     : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTG--------------------------------------
rpigcb_8279.y1      : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACT-------------------------------------------
rcly18b_k11.y1      : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*GGTCAACAA
rcad31b_a13.y1      : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*GGTCAACAA
rcad24b_p16.y1      : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*GGTCAACAA
rcly17b_o1.y1       : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*C*GCAA*GGTCAACAA
rcly36b_f24.y1      : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*GGTCAACAA
rcly27b_b14.y1      : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*GGTCAACAA
rcly11b_c9.y1       : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*GGTCAACAA
rcsp02b_g20.y1      : *CAACA*GCACCTACC*GC*G-------------------------------------------------------------------------------
rcly06b_h14.y1      : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*GGTCAACAA
rcly18b_e5.y1       : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*GGTCAACAA
rcly32b_d18.y1      : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*GGTCAACAA
rcly37b_b8.y1       : *CAACAtGCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAGtGACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*GGTCAACAA
rcly06b_d7.y1       : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AGGGAGTTCAA*G*T*GCAA*GGTCAACAA
rcad22b_o19.y1      : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*GGTCAACAA
rcly40b_n5.y1       : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*GGTCAACAA
rcly11b_n10.y1      : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*GGTCAACAA
rpigcb_14123.y1     : ----------------------------------------------------------------------------------------------------
rcly31b_b13.y1      : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTGgGA*G*T*GCAA*GGTCAACAA
rcly07b_l10.y1      : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*GGTCAACAA
rcad14b_h20.y1      : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*GGTCAACAA
rpigcb_2751.y1      : *CAACA*GCACCTACCtGC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*GGTCAACAA
rcly39b_a18.y1      : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*GGTCAACAA
rcly09b_l2.y1       : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*GGTCAACAA
rcly17b_i20.y1      : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*GGTCAACAA
rcly20b_c2.y1       : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*GGTCAACAA
rcad22b_i10.y1      : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*GGTCAACAA
rcly26b_g14.y1      : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*GGTCAACAA
rcbl0_008480.y1     : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*GGTCAACAA
rcad15b_k7.y1       : *CAACA*GCACCTACCtGC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*GGTCAACAA
rcad22b_i2.y1       : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*GGTCAACAA
rcly23b_k12.y1      : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*GGTCAACAA
rcsp34b_b12.y1      : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*GGTCAACAA
rcad28b_j9.y1       : *CAACA*GCGCCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*GGTCAACAA
rcad34b_k13.y1      : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*GGTCAACAA
rcly29b_e22.y1      : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*GGTCAACAA
rcly37b_n13.y1      : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*GGTCAACAA
rcly14b_k15.y1      : *CAACA*GCACCTACCtGCtGTT*GTCAGCtGTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*GGTCAACAA
rcly25b_n19.y1      : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*GGTCAACAA
rcad23b_a7.y1       : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*GGTCAACAA
rpigcb_8362.y1      : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*GGTCAACAA
rcsp34b_o1.y1       : *CAACA*GCACCTACC*GG*GTG*GTCAGCtGTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*GGTCAACAA
rcad10b_i18.y1      : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAACtGGG*AAGGAGTTCAATG*T*GcA-----------
rpigcb_15128.y1     : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*GGTCAACAA
rcsp27b_e14.y1      : *CAACA*GCACCTACC*GC*GTGtGTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*GGTCAACAA
rcsp35b_p19.y1      : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*GGTCAACAA
rcly06b_g12.y1      : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*GGTCAACAA
rcsp27b_g7.y1       : *CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*GGTCAACAA
rcad14b_g9.y1       : -CAACA*GCACCTACC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*GGTCAACAA
rcje31_o17.y1       : --------------CC*GC*GTG*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*GGTCAACAA
rcsp22b_c19.y1      : ----------------------G*GTCAGCtGTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*GgT*GcAAtGGTCAACAA
rcsp18b_a10.y1      : ----------------------G*GTCAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*G*GcGA*GGTCAACAA
rlnt14c_m11.y1      : --------------------------CAGC*GTCCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAATG*T*GCAA*GGTCAACAA
rcly07b_m22.y1      : ---------------------------------CCTGCCCATCCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GcAAtGGTCAACAA
rcly14b_g19.y1      : -----------------------------------------tTCAGCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*GGTCAACAA
rcly37b_j8.y1       : -----------------------------------------ttcGGCACGAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*GGTCAACTA
rcsp24b_f18.y1      : ---------------------------------------------GCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAATG*T*GCAA*GGTCAACAA
rcad32b_n20.y1      : ---------------------------------------------GCACCAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*GGTCAACAA
rcad09b_n19.y1      : -------------------------------------------------CAG*GACTGGCTGAAC*GGG*AAGGAGTTCAA*G*T*GCAA*GGTCAACAA
rmcp17c_j21.y1      : -----------------------------------------------------GACTGGCTGAAC*GGG*AAGGAGTTCAATG*T*GcAAtGGTCAACAA

----------------------------------------------------------------------
BGISUSX0002000550   : CAA*AGACCTCCCAGCCCCCATCACAA*GGATCATCTCCAAGGCCAAA
rcad17b_n6.y1       : ------------------------------------------------
rcad21b_p24.y1      : CAA*AGACCTCCCAGCC-------------------------------
rcad20b_b23.y1      : CAA*AGACCTCCCAGA--------------------------------
rcbl0_020694.y1     : CAAcAGACCTCCCAGCCCC-----------------------------
rcbl0_014322.y1     : ------------------------------------------------
rcsp24b_g24.y1      : ------------------------------------------------
rcly10b_g6.y1       : ------------------------------------------------
rcbl0_022792.y1     : ------------------------------------------------
rcsp28b_i10.y1      : ------------------------------------------------
rcsp24b_d19.y1      : ------------------------------------------------
rcad06b_i24.y1      : ------------------------------------------------
rcad02b_b22.y1      : ------------------------------------------------
rcly11b_g5.y1       : ------------------------------------------------
rcad05b_k22.y1      : ------------------------------------------------
rcad13b_m19.y1      : ------------------------------------------------
rcly07b_f8.y1       : ------------------------------------------------
rcly34b_g1.y1       : ------------------------------------------------
rcly15b_o1.y1       : ------------------------------------------------
rcly35b_b7.y1       : ------------------------------------------------
rpigcb_9166.y1      : ------------------------------------------------
rcly22b_g4.y1       : ------------------------------------------------
rcly30b_e21.y1      : ------------------------------------------------
rcly32b_h3.y1       : ------------------------------------------------
rpigfat_7163.y1     : ------------------------------------------------
rcly27b_p19.y1      : ------------------------------------------------
rpigcb_11807.y1     : ------------------------------------------------
rpigcb_16924.y1     : ------------------------------------------------
rcly39b_p3.y1       : ------------------------------------------------
rpigcb_15369.y1     : ------------------------------------------------
rcly38b_o24.y1      : ------------------------------------------------
rcbl0_007605.y1     : ------------------------------------------------
rcad23b_h20.y1      : ------------------------------------------------
rcsp06b_g12.y1      : CAA*AGACCTCCCAG---------------------------------
rcly28b_m21.y1      : CAA*AGACCTCCCAG---------------------------------
rpigcb_11342.y1     : ------------------------------------------------
rcly16b_n1.y1       : ------------------------------------------------
rcsp36b_j14.y1      : CAA*AGACCTCCCAGC--------------------------------
rcsp28b_m4.y1       : CAA*AGACCTCCCAG---------------------------------
rpigcb_13418.y1     : CAA*AGACCTCCCAG---------------------------------
rcsp26b_m24.y1      : CAA*AGACCTCC------------------------------------
rcly18b_e15.y1      : CAA*A-------------------------------------------
rcly12b_p7.y1       : CAA*AGA-----------------------------------------
rcsp30b_k17.y1      : CAA*A-------------------------------------------
rcad17b_g12.y1      : CAA*AGACCTCCCAG---------------------------------
rcly34b_f3.y1       : ------------------------------------------------
rpigcb_1324.y1      : ------------------------------------------------
rcsp21b_b20.y1      : ------------------------------------------------
rcly26b_p17.y1      : ------------------------------------------------
rcly13b_i2.y1       : CAA*AGAC----------------------------------------
rlnt21c_d16.y1      : CAA*AGACCTCCCAG---------------------------------
rcly16b_p4.y1       : ------------------------------------------------
rpigcb_14348.y1     : ------------------------------------------------
rcad28b_k21.y1      : CAA*AGACCTCCCAG---------------------------------
rcov32b_h15.y1      : CAA*AGACCTCCCAG---------------------------------
rpigcb_8386.y1      : ------------------------------------------------
rcly31b_c10.y1      : CAA*AGACCTCCCAG---------------------------------
rcly35b_i5.y1       : CAA*AGACCTCCCA----------------------------------
rlnt02c_b24.y1      : CAA*AG------------------------------------------
rcly26b_o9.y1       : ------------------------------------------------
rpigca0_006920.y1   : ------------------------------------------------
rlnt31c_n18.y1      : ------------------------------------------------
rcly30b_d15.y1      : ------------------------------------------------
rcli06b_f3.y1       : ------------------------------------------------
rcsp12b_g16.y1      : ------------------------------------------------
rcad35b_k21.y1      : CAA*AGACCTCCCAG---------------------------------
rpigcb_15563.y1     : ------------------------------------------------
rpigcb_8279.y1      : ------------------------------------------------
rcly18b_k11.y1      : CAA*AGACCTCCCAG---------------------------------
rcad31b_a13.y1      : CAA*AGACCTCCCAG---------------------------------
rcad24b_p16.y1      : CAA*AGACCTCCCAG---------------------------------
rcly17b_o1.y1       : CAA*AGACCTCCCAG---------------------------------
rcly36b_f24.y1      : CAA*AGACCTCCCAG---------------------------------
rcly27b_b14.y1      : CAA*AGACCTCCCAG---------------------------------
rcly11b_c9.y1       : CAA*AGACCTCCCAGC--------------------------------
rcsp02b_g20.y1      : ------------------------------------------------
rcly06b_h14.y1      : CAA*AGACCTCCCAGCCCC-----------------------------
rcly18b_e5.y1       : CAA*AGACCTCCCAGCC-------------------------------
rcly32b_d18.y1      : CAA*AGACCTCCCAGCC-------------------------------
rcly37b_b8.y1       : CAA*AGACCTCCCAGCCCCC----------------------------
rcly06b_d7.y1       : CAA*AGACCTCCCAGCCCC-----------------------------
rcad22b_o19.y1      : CAA*AGACCTCCCAGCC-------------------------------
rcly40b_n5.y1       : CAA*AGACCTCCCAGCCC------------------------------
rcly11b_n10.y1      : CAA*AGACCTCCCAGCC-------------------------------
rpigcb_14123.y1     : ------------------------------------------------
rcly31b_b13.y1      : CAA*AGACCTCCCAGCC-------------------------------
rcly07b_l10.y1      : CAA*AGACCTCCCAGCC-------------------------------
rcad14b_h20.y1      : CAA*AGACCTCCCAGCC-------------------------------
rpigcb_2751.y1      : CAA*AGACCTCCCAGCCC------------------------------
rcly39b_a18.y1      : CAA*AGACCTCCCAGCCC------------------------------
rcly09b_l2.y1       : CAA*AGACCTCCCAGCCCCC----------------------------
rcly17b_i20.y1      : CAA*AGACCTCCCAGCC-------------------------------
rcly20b_c2.y1       : CAA*AGACCTCCCAGCC-------------------------------
rcad22b_i10.y1      : CAA*AGACCTCCCAGCCC------------------------------
rcly26b_g14.y1      : CAA*AGACCTCCCAGCCCCCATCAC-----------------------
rcbl0_008480.y1     : CAA*AGACCTCCCAGCCCCCATC-------------------------
rcad15b_k7.y1       : CAA*AGACCTCCCAGCCCCCATCACAA*--------------------
rcad22b_i2.y1       : CAA*AGACCTCCCAGCCCCCAT--------------------------
rcly23b_k12.y1      : CAA*AGACCTCCCAGCCCCCA---------------------------
rcsp34b_b12.y1      : CAA*AGACCTCCCAGCCCCCATCA------------------------
rcad28b_j9.y1       : CAA*AGACCTCCCAGCCCCCATCA------------------------
rcad34b_k13.y1      : CAA*AGACCTCCCAGCCCCCAT--------------------------
rcly29b_e22.y1      : CAA*AGACCTCCCAGCCCCCATCA------------------------
rcly37b_n13.y1      : CAA*AGACCTCCCAGCCCCCATCA------------------------
rcly14b_k15.y1      : CAA*AGACCTCCCAGCCCCCA---------------------------
rcly25b_n19.y1      : CAA*AGACCTCCCAGCCCCCATCA------------------------
rcad23b_a7.y1       : CAA*AGACCTCCCAGCCCCCATCACA----------------------
rpigcb_8362.y1      : CAA*AGACCTCCCAGCCCCCATCACAA*G-------------------
rcsp34b_o1.y1       : CAA*AGACCTCCCAGCCCCCATCACAA*GGA-----------------
rcad10b_i18.y1      : ------------------------------------------------
rpigcb_15128.y1     : CAA*AGACCTCCCAGCCCCCATCACAA*GGA-----------------
rcsp27b_e14.y1      : CAA*AGACCTCCCAGCCCCCATCACAA*GGATCAT-------------
rcsp35b_p19.y1      : CAA*AGACCTCCCAGCCCCCATCACAA*GGATCA--------------
rcly06b_g12.y1      : CAA*AGACCTCCCAGCCCCCATCACAA*GGATCA--------------
rcsp27b_g7.y1       : CAA*AGACCTCCCAGCCCCCATCAC-----------------------
rcad14b_g9.y1       : CAA*AGACCTCCCAGCCCCCATCACAA*GGATCATC------------
rcje31_o17.y1       : CAA*AGACCTCCCAGCCCCCATCACAA*GGATCATCT-----------
rcsp22b_c19.y1      : CAA*AGACCTCCCAGCCCCCATCACAA*GGATCATCTCCAAG------
rcsp18b_a10.y1      : CAA*AGACCTCCCAGCCCCCATCACAA*GGATCATCTCC---------
rlnt14c_m11.y1      : CAA*AGACCTCCCAGCCCCCATCACAA*GGATCATCTCCAA-------
rcly07b_m22.y1      : CAA*AGACCTCCCAGCCCCCATCACAAtGGATCATCTCCAAGG-----
rcly14b_g19.y1      : CAA*AGACCTCCCAGCCCCCATCACAA*GGATCATCTCCAA-------
rcly37b_j8.y1       : CAA*AGACCTCCCAGCCCCCATCACAA*GGATCATCTCCAA-------
rcsp24b_f18.y1      : CAA*GGAGcTCCCAGCCCCCATCACAA*GGATCATCTCCAAG------
rcad32b_n20.y1      : CAA*AGACCTCCCAGCCCCCATCACAA*GGATCATCTCCAA-------
rcad09b_n19.y1      : CAA*AGACCTCCCAGCCCCCATCACAA*GGATCATCTCCAA-------
rmcp17c_j21.y1      : CAA*AGACCTCCCAGCCCCCATCACAA*GGATCATCTCCAAGGC----

Cited by

ENST00000251006