Sequences

BGISUSX0002000557

Source Seq Type : est

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>BGISUSX0002000557
GGGATCGCCAGGCACATGCCGTCCGTGTACGTGCTGCCGCCGGCCCCGGAGGAGCTGAGCCTGCAGGAGTGGGCCTCGGTCACCTGCCTGGTGAAGGGCT
TCTCCCCGGCGGACGTGTTCGTGCAGTGGCTGCAGAAGGGGGAGCCCGTGTCCGCCGACAAGTACGTGACCAGCGCGCCGGTGCCCGAGCCCGAGCCCAA
GGCCCCCGCCTCCTACTTCGTGCAGAGCGTCCTGACGGTGAGCGCCAAGGACTGGAGCGACGGGGAGACCTACACCTGCGTCGTGGGCCACGAGGCCCTG
CCCCACACGGTGACCGAGAGGACCGTGGACAAGTCCACCGGTAAACCCACCCTGTACAACGTCTCCCTGGTCCTGTCCGACACGGCCAGCACCTGCTACT
GA

Assemble


--------------------------------------------------------------------------------------------------------------------------
BGISUSX0002000557   : GGGATCGCCAGGCACATGC*C*GTCC*GTGTACGTGCTGCCGCCGGCCCCGGAGGAGCTGAGCCTGCAGGAGTGGGCCTCG*GTCACCTGCCTGGTGAA*
rlnt17c_a6.y1       : GGGATCGCCAGGCACATGC*C*GTCC*GTGTACGTGCTGCCGCCGGCCCCGGAGGAGCTGAGCCTGCAGGAGTGGGCCTCG*GTCACCTGCCTGGTGAA*
rmcp28c_i21.y1      : GGGATCGCCAGGCACATGC*C*GTCC*GTGTACGTGCTGCCGCCGGCCCCGGAGGAGCTGAGCCTGCAGGAGTGGGCCTCG*GTCACCTGCCTGGTGAA*
rcsp27b_n11.y1      : GGGATCGCCAGGCACATGC*C*GTCC*GTGTACGTGCTGCCGCCGGCCCCGGAGGAGCTGAGCCTGCAGGAGTGGGCCTCG*GTCACCTGCCTGGTGAA*
rcsp24b_d24.y1      : GGGATCGCCAGGCACATGC*C*GTCC*GTGTACGTGCTGCCGCCGGCCCCGGAGGAGCTGAGCCTGCAGGAGTGGGCCTCG*GTCACCTGCCTGGTGAA*
rcsp29b_d11.y1      : GGGATCGCCAGGCACATGC*C*GTCC*GTGTACGTGCTGCCGCCGGCCCCGGAGGAGCTGAGCCTGCAGGAGTGGGCCTCG*GTCACCTGCCTGGTGAA*
rcsp26b_o20.y1      : GGGATCGCCAGGCACATGC*C*GTCC*GTGTACGTGCTGCCGGCGGCCCCGGAGGAGCTGAGCCTGCAGGAGTGGGCCTCG*GTCACCTGCCTGGTGAA*
rcst19_l24.y1       : GGGATCGCCAGGCACATGC*C*GTCC*GTGTACGTGCTGCCGCCGGCCCCGGAGGAGCTGAGCCTGCAGGAGTGGGCCTCG*GTCACCTGCCTGGTGAA*
rspl31_m12.y1       : GGGATCGCCAGGCACATGC*C*GTCC*GTGTACGTGCTGCCGCCGGCCCCGGAGGAGCTGAGCCTGCAGGAGTGGGCCTCG*GTCACCTGCCTGGTGAA*
rcsp16b_h18.y1      : GGGATCGCCAGGCACATGC*C*GTCC*GTGTACGTGCTGCCGCCGGCCCCGGAGGAGCTGAGCCTGCAGGAGTGGGCCTCG*GTCACCTGCCTGGTGAA*
rsin04_e6.y1        : GGGATCGCCAGGCACATGC*C*GTCC*GTGTACGTGCTGCCGCCGGCCCCGGAGGAGCTGAGCCTGCAGGAGTGGGCCTCG*GTCACCTGCCTGGTGAA*
rcsp21b_o3.y1       : ------GCCAGGCACATGCgC*GGGC*GTGTACGTGCTGCCGCCGGCCCCGGAGGAGCTGAGCCTGCAGGAGTGGGCCTCG*GTCACCTGCCTGGTGAA*
rcsp07b_n20.y1      : ----------TGCACATGC*CtGTCCtGTGTACGTGCTGCCGCCGGCCCCGGAGGAGCTGAGCCTGCAGGAGTGGGCCTCG*GTCACCTGCCTGGTGAA*
rcsp12b_d24.y1      : -----------GCACATGC*C*GTCC*GTGTACGTGCTGCCGCCGGCCCCGGAGGAGCTGAGCCTGCAGGAGTGGGCCTCG*GTCACCTGCCTGGTGAA*
rcsp39b_j19.y1      : -----------GCACATGC*C*GTCC*GTGTACGTGCTGCCGCCGGCCCCGGAGGAGCTGAGCCTGCAGGAGTGGGCCTCG*GTCACCTGCCTGGTGAA*
pigca_1159.z1       : -----------GCACATGC*C*GTCC*GTGTACGTGCTGCCGCCGGCCCCGGAGGAGCTGAGCCTGCAGGAGTGGTCCTCG*GTCACCTGCCTGGTGAA*
rpigca0_005101.y1   : -------------ACATGC*C*GTCC*GTGTACGTGCTGCCGCCGGCCCCGGAGGAGCTGAGCCTGCAGGAGTGGGCCTCGtGTCACCTGCCTGGTGAA*
rcsp23b_m20.y1      : ----------------GGC*C*GTCC*GTGTACGTGCTGCCGCCGGCCCCGGAGGAGCTGAGCCTGCAGGAGGGGGCCTCG*GTCACCTGCCTGGTGAA*
rnlu1812b_a14.y1    : ----------------------cgTC*GTGTACGTGCTGC*GcCGG*CCCGGAGGAGCTGAGCCTGCAGGAGGGGGCCTCG*GTCACCTGCCTGGTGAA*
rcly10b_c15.y1      : ---------------------------GTGTACGTGCTGCCG*CGGCCCCGGAGGAGCTGAGCCTGCAGGAGTGGGCCTCG*GTCACCTGCCTGGTGAA*
rcsp30b_a22.y1      : -----------------------------------GCTGCCGCCGGCCCCGGAGGAGCTGAGCCTGCAGGAGTGGGCCTCG*GTCACCTGCCTGGTGAA*
rcga35b_k8.y1       : ----------------------------------------------CCCCGGAGGAGCTGAGCCTGCAGGAGTGGGCCTCG*GTCACCTGGCTGGTGAAc
rcsp32b_a21.y1      : -------------------------------------------------GGGAGGAGCTGAGCCTGCAGGAGTGGGCCTCGtGTCACCTGCCTGGTGAA*
rpigcb_10295.y1     : -------------------------------------------------------AGCTGAGCCTGCAGGAGTGGGCCTCG*GTCACCTGCCTGGTGAA*
rcly40b_m15.y1      : --------------------------------------------------------GCTGAGCCTGCAGGAGTGGGCCTCG*GTCACCTGCCTGGTGAA*
rpigcb_15942.y1     : ---------------------------------------------------------------ctgcaggaattcggcacg*aggACCTGCCTGGTGAA*
rcsp25b_n22.y1      : -----------------------------------------------------------------GCAGGAGTGGGCCTCG*GTCACCTGCCTGGTGAA*
rcad18b_p15.y1      : -------------------------------------------------------------------GGGAGTGGGCCTCG*GTCACCTGCCTGGTGAA*
rcsp16b_j14.y1      : --------------------------------------------------------------------------GGCCTCG*GTCACCTGCCTGGTGAA*
rcsp18b_h16.y1      : -----------------------------------------------------------------------------------TCACCTGCCTGGTGAA*
rcly08b_p10.y1      : -----------------------------------------------------------------------------------TCACCTGCCTGGTGAA*
rcsp17b_f13.y1      : ----------------------------------------------------------------------------------------TGCCTGGTGAA*
rcsp32b_a20.y1      : --------------------------------------------------------------------------------------------TGGTGAA*
rcga18b_m17.y1      : -----------------------------------------------------------------------------------------GCCTGGTGAA*
rcad27b_b2.y1       : ---------------------------------------------------------------------------------------------GGTGAA*
rcad14b_l13.y1      : ----------------------------------------------------------------------------------------------------
rcsp30b_f16.y1      : ----------------------------------------------------------------------------------------------------
rcsp16b_p12.y1      : ----------------------------------------------------------------------------------------------------
rcly24b_f16.y1      : ----------------------------------------------------------------------------------------------------
rcad22b_e5.y1       : ----------------------------------------------------------------------------------------------------
rcad16b_o7.y1       : ----------------------------------------------------------------------------------------------------
rcsp30b_d8.y1       : ----------------------------------------------------------------------------------------------------
rcly06b_c15.y1      : ----------------------------------------------------------------------------------------------------
rcsp36b_p23.y1      : ----------------------------------------------------------------------------------------------------
rcsp04b_c18.y1      : ----------------------------------------------------------------------------------------------------
rcga34b_o23.y1      : ----------------------------------------------------------------------------------------------------
rcsp34b_i18.y1      : ----------------------------------------------------------------------------------------------------
rcsp33b_k21.y1      : ----------------------------------------------------------------------------------------------------
rcsp03b_l15.y1      : ----------------------------------------------------------------------------------------------------
rcad26b_a12.y1      : ----------------------------------------------------------------------------------------------------
rcsp30b_d10.y1      : ----------------------------------------------------------------------------------------------------
rcsp08b_m13.y1      : ----------------------------------------------------------------------------------------------------
rcsp11b_k9.y1       : ----------------------------------------------------------------------------------------------------
rcsp24b_g4.y1       : ----------------------------------------------------------------------------------------------------
rcsp12b_m23.y1      : ----------------------------------------------------------------------------------------------------
rcsp17b_n7.y1       : ----------------------------------------------------------------------------------------------------
rcly06b_g1.y1       : ----------------------------------------------------------------------------------------------------
rcsp09b_h4.y1       : ----------------------------------------------------------------------------------------------------
rcsp27b_e20.y1      : ----------------------------------------------------------------------------------------------------
rcsp11b_l20.y1      : ----------------------------------------------------------------------------------------------------
rcly15b_n13.y1      : ----------------------------------------------------------------------------------------------------
rcsp40b_g8.y1       : ----------------------------------------------------------------------------------------------------
rcsp23b_m12.y1      : ----------------------------------------------------------------------------------------------------
rcsp33b_e9.y1       : ----------------------------------------------------------------------------------------------------
rcsp03b_k11.y1      : ----------------------------------------------------------------------------------------------------
rcsp09b_a12.y1      : ----------------------------------------------------------------------------------------------------
rcad18b_l16.y1      : ----------------------------------------------------------------------------------------------------
rjej18b_e9.y1       : ----------------------------------------------------------------------------------------------------
rpigca_0210.y1      : ----------------------------------------------------------------------------------------------------
rcsp20b_m11.y1      : ----------------------------------------------------------------------------------------------------
rcsp34b_m13.y1      : ----------------------------------------------------------------------------------------------------
rcsp30b_i11.y1      : ----------------------------------------------------------------------------------------------------
rcsp11b_k4.y1       : ----------------------------------------------------------------------------------------------------
rcsp05b_o23.y1      : ----------------------------------------------------------------------------------------------------
rcbl0_016523.y1     : ----------------------------------------------------------------------------------------------------
rcsp33b_n9.y1       : ----------------------------------------------------------------------------------------------------
rcsp33b_h22.y1      : ----------------------------------------------------------------------------------------------------
rcga28b_j17.y1      : ----------------------------------------------------------------------------------------------------
rcsp38b_k11.y1      : ----------------------------------------------------------------------------------------------------
rcly38b_h2.y1       : ----------------------------------------------------------------------------------------------------
rcad09b_b15.y1      : ----------------------------------------------------------------------------------------------------
rcsp19b_i2.y1       : ----------------------------------------------------------------------------------------------------
rcsp05b_l15.y1      : ----------------------------------------------------------------------------------------------------
rcad10b_g8.y1       : ----------------------------------------------------------------------------------------------------

--------------------------------------------------------------------------------------------------------------------------
BGISUSX0002000557   : GGGCTT*CTCCCCGGCGGACGTG*TTC*GTGCAGTGGCTGCAGAAGGGGGAGCCC*GTGT*CC*GC*CGACAAGTACGTGACCAGCGCGCC*G*G*TGC*
rlnt17c_a6.y1       : GGGCTT*CTCCCCGGCGGACGTG*TTC*GTGCAGTGGCTGCAGAAGGGGGAGCCC*GTGT*CC*GC*CGAGGAGTACGTGACCAGCGCGCC*G*G*TGC*
rmcp28c_i21.y1      : GGGCTT*CTCCCCGGCGGACGTG*TTC*GTGCAGGGGCTGCAGAAGGGGGAGCCC*GTGT*CC*GC*CGACAAGTACGTGACCAGCGCGCC*G*G*TGC*
rcsp27b_n11.y1      : GGGCTT*CTCCCCGGCGGACGTG*TTC*GTGCAGTGGCTGCAGAAGGGGGAGCCC*GTGT*CC*GC*CGACAAGTACGTGACCAGCGCGCC*G*G*TGC*
rcsp24b_d24.y1      : GGGCTT*CTCCCCGGCGGACGTG*TTC*GTGCAGTGGCTGCAGAAGGGGGAGCCC*GTGT*CC*GC*CGACAAGTACGTGACCAGCGCGCC*G*G*TGC*
rcsp29b_d11.y1      : GGGCTT*CTCCCCGGCGGACGTG*TTC*GTGCAGTGGCTGCAGAAGGGGGAGCCC*GTGT*CC*GC*CGACAAGTACGTGACCAGCGCGCC*G*G*TGC*
rcsp26b_o20.y1      : GGGCTT*CTCCCCGGCGGACGTG*TTC*GTGCAGTGGCTGCAGAAGGGGGAGCCC*GTGT*CC*GC*CGACAAGTACGTGACCAGCGCGCC*G*G*TGC*
rcst19_l24.y1       : GGGCTT*CTCCCCGGCGGACGTG*TTC*GTGCAGTGGCTGCAGAAGGGGGAGCCC*GTGT*CC*GC*CGACAAGTACGTGACCAGCGCGCC*G*G*TGC*
rspl31_m12.y1       : GGGCTT*CTCCCCGGCGGACGTG*TTC*GTGCAGTGGCTGCAGAAGGGGGAGCCC*GTGT*CC*GC*CGACAAGTACGTGACCAGCGCGCC*G*G*TGC*
rcsp16b_h18.y1      : GGGCTT*CTCCCCGGCGGACGTG*TTC*GTGCAGTGGCTGCAGAAGGGGGAGCCC*GTGT*CC*GC*CGACAAGTACGTGACCAGCGCGCC*G*G*TGC*
rsin04_e6.y1        : GGGCTT*CTCCCCGGCGGACGTG*TTC*GTGCAGTGGCTGCAGAAGGGGGAGCCC*GTGT*CC*GC*CGACAAGTACGTGACCAGCGCGCC*G*G*TGC*
rcsp21b_o3.y1       : GGGCTT*CTCCCCGGCGGACGTG*TTC*GTGCAGTGGCTGCAGAAGGGGGAGCCC*GTGT*CC*GC*CGACAAGTACGTGAgCAGCGCGCC*G*G*TGC*
rcsp07b_n20.y1      : GGGCTT*CTCCCCGGCGGACGTG*TTC*GTGCAGTGGCTGCAGAAGGGGGAGCCC*GTGT*CC*GC*CGACAAGTACGTGACCAGCGCGCC*G*G*TGC*
rcsp12b_d24.y1      : GGGCTT*CTCCCCGGCGGACGTG*TTC*GTGCAGTGGCTGCAGAAGGGGGAGCCC*GTGT*Cc*GG*CGACAAGTACGTGACCAGCGCGCC*G*G*TGC*
rcsp39b_j19.y1      : GGGCTT*CTCCCCGGCGGACGTG*TTC*GTGCAGTGGCTGCAGAAGGGGGAGCCC*GTGT*CC*GC*CGACAAGTACGTGACCAGCGCGCC*G*G*TGC*
pigca_1159.z1       : GGGCTT*CTCCCCGGCGGACGTG*TTC*GTTCAGTGGCTGCAGAAGGGGGAGCCC*GTGT*CC*GC*CGACAAGTACGTGACCAGCGCGCC*G*G*TGC*
rpigca0_005101.y1   : GGGCTT*CTCCCCGGCGGACGTG*TTC*GTGCAGTGGCTGCAGAAGGGGGAGCCC*GTGT*CC*GC*CGACAAGTACGTGACCAGCGCGCC*G*G*TGC*
rcsp23b_m20.y1      : GGGCTT*CTCCCCGGCGGACGTG*TTC*GTGCAGTGGCTGCAGAAGGGGGAGCCC*GTGT*CC*GC*CGACAAGTACGTGACCAGCGCGCC*G*G*TGC*
rnlu1812b_a14.y1    : GGGCTT*CTCCCCGGCGGACGTG*TTC*GTGCAGTGGCTGCAGAAGGGGGAGCCC*GTGT*CC*GC*CGACAAGTACGTGACCAGCGCGCC*G*G*TGC*
rcly10b_c15.y1      : GGGCTT*CTCCCCGGCGGACGTG*TTC*GTGCAGTGGCTGCAGAAGGGGGAGCCC*GTGT*CC*GC*CGACAAGTACGTGACCAGCGCGCC*G*G*TGC*
rcsp30b_a22.y1      : GGGCTT*CTCCCCGGCGGACGTG*TTC*GTGCAGTGGCTGCAGAAGGGGGAGCCC*GTGT*CC*GC*CGACAAGTACGTGACCAGCGCGCC*G*G*TGC*
rcga35b_k8.y1       : GGGCTT*CTCCCCGGCGGACGTG*TTCtGTGCAGTGGCTGCAGAAGGGGGAGCCC*GTGT*CC*GC*CGACAAGTACGTGACCAGCGCGCC*G*G*TGC*
rcsp32b_a21.y1      : GGGCGTgCTCCCCGGCGGACGTG*TTC*GTGCAGTGGCTGCAGAAGGGGGAGCCC*GTGT*CC*GC*CGACAAGTACGTGACCAGCGCGCC*G*G*TGC*
rpigcb_10295.y1     : GGGCTT*CTCCCCGGCGGACGTG*TTC*GTGCAGTGGCTGCAGAAGGGGGAGCCC*GTGT*CC*GC*CGACAAGTACGTGACCAGCGCGCC*G*G*TGC*
rcly40b_m15.y1      : GGGCTT*CTCCCCGGCGGACGTG*TTCtGTGCAGTGGCTGCAGAAGGGGGAGCCC*GTGT*CC*GC*CGACAAGTACGTGACCAGCGCGCC*G*G*TGC*
rpigcb_15942.y1     : GGGCTT*CTCCCCGGCGGACGTG*TTC*GTGCAGTGGCTGCAGAAGGGGGAGCCC*GTGT*CC*GC*CGACAAGTACGTGACCAGCGCGCC*G*G*TGC*
rcsp25b_n22.y1      : GGGCTT*CTCCCCGGCGGACGTG*TTC*GTGCAGTGGCTGCAGAAGGGGGAGCCC*GTGT*CC*GC*CGACAAGTACGTGACCAGCGCGCC*G*G*TGC*
rcad18b_p15.y1      : GGGCTT*CTCCCCGGCGGACGTG*TTC*GTGCAGTGGCTGCAGAAGGGGGAGCCC*GTGT*CC*GC*CGACAAGTACGTGACCAGCGCGCC*G*G*TGC*
rcsp16b_j14.y1      : GGGCTT*CTCCCCGGCGGACGTG*TTC*GTGCAGTGGCTGCAGAAGGGGGAGCCC*GTGC*tc*GC*CGACAAGTACGTGACCAGCGCGCC*G*G*TGC*
rcsp18b_h16.y1      : GGGCTT*CTCCCCGGCGGACGTG*TTC*GTGCAGTGGCTGCAGAAGGGGGAGCCC*GTGT*CctGC*CGACAAGTACGTGACCAGCGCGCC*G*G*TGC*
rcly08b_p10.y1      : GGGCTT*CTCCCCGGCGGACGTG*TTC*GTGCAGTGGCTGCAGAAGGGGGAGCCC*GTGT*CC*GC*CGACAAGTACGTGACCAGCGCGCC*G*G*TGC*
rcsp17b_f13.y1      : GGGCTT*CTCCCCGGCGGACGTG*TTC*GTGCAGTGGCTGCAGAAGGGGGAGCCC*GTGT*ct*GC*CGACAAGTACGTGACCAGCGCGCCtG*G*TGC*
rcsp32b_a20.y1      : GGGCTT*CTCCCCGGCGGACGTGtTTC*GTGCAGTGGCTGCAGAAGGGGGAGCCC*GTGTtcC*GC*CGACAAGTACGTGACCAGCGCGCC*G*G*TGC*
rcga18b_m17.y1      : GGGCTT*CTCCCCGGCGGACGTG*TTC*GTGCAGTGGCTGCAGAAGGGGGAGCCC*GTGT*CC*GC*CGACAAGTACGTGACCAGCGCGCC*G*G*TGC*
rcad27b_b2.y1       : GGGCTT*CTCCCCGGCGGACGTG*TTC*GTGCAGTGGCTGCAGAAGGGGGAGCCC*GTGTacc*GC*CGACAAGTACGTGACCAGCGCGCC*G*G*TGC*
rcad14b_l13.y1      : ---------CCCCGGCGGACGTG*TTC*GTGCAGTGGCTGCAGAAGGGGGAGCCC*GTGT*CC*GCaCGACAAGTACGTGACCAGCGCGCC*G*G*TGC*
rcsp30b_f16.y1      : ---------CCCCGGCGGACGTG*TTC*GTGCAGTGGCTGCAGAAGGGGGAGCCC*GTGT*ac*GC*GGACAAGTACGTGACCAGCGCGCC*GtG*TGC*
rcsp16b_p12.y1      : -----------CCGGCGGACGTG*TTC*GTGCAGTGGCTGCAGAAGGGGGAGCCC*GTGT*CC*GC*CGAGAAGTACGTGACCAGCGCGCC*GtG*TGC*
rcly24b_f16.y1      : --------------GCGGACGTG*TTC*GTGCAGTGGCTGCAGAAGGGGGAGCCC*GTGT*CC*GC*CGACAAGTACGTGACCAGCGCGCC*G*G*TGC*
rcad22b_e5.y1       : --------------GCGGACGTG*TTC*GTGCAGTGGCTGCAGAAGGGGGAGCCC*GTGT*CC*GC*CGACAAGTACGTGACCAGCGCGCC*G*G*TGC*
rcad16b_o7.y1       : --------------GCGGACGTG*TTC*GTGCAGTGGCTGCAGAAGGGGGAGCCC*GTGT*CC*GC*CGACGAGTACGTGACCAGCGCGCC*G*G*TGC*
rcsp30b_d8.y1       : --------------GCGGACGTG*TTC*GTGCAGTGGCTGCAGAAGGGGGAGCCC*GTGT**C*GC*CGACAAGTAGGTGACCAGCGCGCC*G*G*TGC*
rcly06b_c15.y1      : -----------------gGCGTG*TTC*GTGCAGTGGCTGCAGAAGGGGGAGCCC*GTGT*CC*GC*CGACAAGTAGGTGACCAGCGCGCC*G*G*TGC*
rcsp36b_p23.y1      : --------------------------C*GTGCAGTGGCTGCAGAAGGGGGAGCCC*GTGT*CC*GC*CGACAAGTACGTGACCAGCGCGCC*G*G*TGC*
rcsp04b_c18.y1      : ----------------------------------TGGCTGCAGAAGGGGGAGCCC*GTGT*Cc*TC*CGACTAGTACGTGACCAGCGCGCC*G*G*TGC*
rcga34b_o23.y1      : -----------------------------------GGCTGCAGAAGGGGGAGCCC*GTGT*CC*GC*CGACAAGTACGTGACCAGCGCGCC*G*G*TGC*
rcsp34b_i18.y1      : --------------------------------------------------AGCCCtGTGT*CC*GC*CGACAAGTACGTGACCAGCGCGCC*G*GgTGCg
rcsp33b_k21.y1      : -------------------------------------------------cggcac*gagg*cC*GC*CGACAAGTACGTGACCAGCGCGCC*G*G*TGC*
rcsp03b_l15.y1      : ---------------------------------------------------GCCC*GTGT*CC*GC*CGACAAGTACGTGACCAGCGCGCC*G*G*TGC*
rcad26b_a12.y1      : ---------------------------------------------------GCCT*GTGT*CC*GC*CGACAAGTACGTGACCAGCGCGCC*G*G*TGC*
rcsp30b_d10.y1      : ---------------------------------------------------GCCC*GTGT*C**GC*CGACAAGTACGTGA*CAGCGCGCC*G*G*TGC*
rcsp08b_m13.y1      : -------------------------------------------------------------cc*GC*CGACAAGTACGTGACCAGCGCGCC*G*G*TGC*
rcsp11b_k9.y1       : --------------------------------------------------------------------GACAAGTACGTGACCAGCGCGCC*G*G*TGC*
rcsp24b_g4.y1       : ----------------------------------------------------------------------gaGGTACGTGACCAGCGCGCC*G*G*TGC*
rcsp12b_m23.y1      : ----------------------------------------------------------------------------TGTGACCAGCGCGCC*G*G*TGC*
rcsp17b_n7.y1       : -----------------------------------------------------------------------------GTGACCAGCGCGCC*G*G*TGC*
rcly06b_g1.y1       : -------------------------------------------------------------------------------------------------cc*
rcsp09b_h4.y1       : -------------------------------------------------------------------------------------------------cc*
rcsp27b_e20.y1      : ----------------------------------------------------------------------------------------------------
rcsp11b_l20.y1      : ----------------------------------------------------------------------------------------------------
rcly15b_n13.y1      : ----------------------------------------------------------------------------------------------------
rcsp40b_g8.y1       : ----------------------------------------------------------------------------------------------------
rcsp23b_m12.y1      : ----------------------------------------------------------------------------------------------------
rcsp33b_e9.y1       : ----------------------------------------------------------------------------------------------------
rcsp03b_k11.y1      : ----------------------------------------------------------------------------------------------------
rcsp09b_a12.y1      : ----------------------------------------------------------------------------------------------------
rcad18b_l16.y1      : ----------------------------------------------------------------------------------------------------
rjej18b_e9.y1       : ----------------------------------------------------------------------------------------------------
rpigca_0210.y1      : ----------------------------------------------------------------------------------------------------
rcsp20b_m11.y1      : ----------------------------------------------------------------------------------------------------
rcsp34b_m13.y1      : ----------------------------------------------------------------------------------------------------
rcsp30b_i11.y1      : ----------------------------------------------------------------------------------------------------
rcsp11b_k4.y1       : ----------------------------------------------------------------------------------------------------
rcsp05b_o23.y1      : ----------------------------------------------------------------------------------------------------
rcbl0_016523.y1     : ----------------------------------------------------------------------------------------------------
rcsp33b_n9.y1       : ----------------------------------------------------------------------------------------------------
rcsp33b_h22.y1      : ----------------------------------------------------------------------------------------------------
rcga28b_j17.y1      : ----------------------------------------------------------------------------------------------------
rcsp38b_k11.y1      : ----------------------------------------------------------------------------------------------------
rcly38b_h2.y1       : ----------------------------------------------------------------------------------------------------
rcad09b_b15.y1      : ----------------------------------------------------------------------------------------------------
rcsp19b_i2.y1       : ----------------------------------------------------------------------------------------------------
rcsp05b_l15.y1      : ----------------------------------------------------------------------------------------------------
rcad10b_g8.y1       : ----------------------------------------------------------------------------------------------------

--------------------------------------------------------------------------------------------------------------------------
BGISUSX0002000557   : CCGAGCCCGAGCCCAA*GGCCCCCGCCTCC*TACTTCGTGCAGAGC*GTCCTGACGGTGAGC*GCCAAGGACTGGAGCGA*CGGGGAGACCTACACCTGC
rlnt17c_a6.y1       : CCGAGCCCGAGCCCAA*GGCCCCCGCCTCC*TACTTCGTGCAGAGC*GTCCTGACGGTGAGC*GCCAAGGACTGGAGCGA*CGGGGAGACCTACACCTGC
rmcp28c_i21.y1      : CCGAGCCCGAGCCCAA*GGCCCCCGCCTCC*TACTTCGTGCAGAGC*GTCCTGACGGTGAGC*GCCAAGGACTGGAGCGA*CGGGGAGACCTACACCTGC
rcsp27b_n11.y1      : CCGAGCCCGAGCCCAA*GGCCCCCGCCTCC*TACTTCGTGCAGAGC*GTCCTGACGGTGAGC*GCCAAGGACTGGAGCGA*CGGGGAGACCTACACCTGC
rcsp24b_d24.y1      : CCGAGCCCGAGCCCAA*GGCCCCCGCCTCC*TACTTCGTGCAGAGC*GTCCTGACGGTGAGC*GCCAAGGACTGGAGCGA*CGGGGAGACCTACACCTGC
rcsp29b_d11.y1      : CCGAGCCCGAGCCCAA*GGCCCCCGCCTCC*TACTTCGTGCAGAGC*GTCCTGACGGTGAGC*GCCAAGGACTGGAGCGA*CGGGGAGACCTACACCTGC
rcsp26b_o20.y1      : CCGAGCCCGAGCCCAA*GGCCCCCGCCTCC*TACTTCGTGCAGAGC*GTCCTGACGGTGAGC*GCCAAGGACTGGAGCGA*CGGGGAGACCTACACCTGC
rcst19_l24.y1       : CCGAGCCCGAGCCCAA*GGCCCCCGCCTCC*TACTTCGTGCAGAGC*GTCCTGACGGTGAGC*GGCAAGGACTGGAGCGA*CGGGGAGACCTACACCTGC
rspl31_m12.y1       : CCGAGCCCGAGCCCAA*GGCCCCCGCCTCC*TACTTCGTGCAGAGC*GTCCTGACGGTGAGC*GCCAAGGACTGGAGCGA*CGGGGAGACCTACACCTGC
rcsp16b_h18.y1      : CCGAGCCCGAGCCCAA*GGCCCCCGCCTCC*TACTTCGTGCAGAGC*GTCCTGACGGTGAGC*GCCAAGGACTGGAGCGA*CGGGGAGACCTACACCTGC
rsin04_e6.y1        : CCGAGCCCGAGCCCAA*GGCCCCCGCCTCC*TACTTCGTGCAGAGC*GTCCTGACGGTGAGC*GCCAAGGACTGGAGCGA*CGGGGAGACCTACACCTGC
rcsp21b_o3.y1       : CCGAGCCCGAGCCCAA*GGCCCCCGCCTCC*TACTTCGTGCAGAGC*GTCCTGACGGTGAGC*GCCAAGGACTGGAGCGA*CGGGGAGACCTACACCTGC
rcsp07b_n20.y1      : CCGAGCCCGAGCCCAA*GGCCCCCGCCTCC*TACTTCGTGCAGAGC*GTCCTGACGGTGAGCtGCCAAGGACTGGAGCGA*CGGGGAGACCTACACCTGC
rcsp12b_d24.y1      : CCGAGCCCGAGCCCAA*GGCCCCCGCCTCC*TACTTCGTGCAGAGC*GTCCTGACGGTGAGC*GCCAAGGACTGGAGCGA*CGGGGAGACCTACACCTGC
rcsp39b_j19.y1      : CCGAGCCCGAGCCCAA*GGCCCCCGCCTCC*TACTTCGTGCAGAGC*GTCCTGACGGTGAGC*GCCAAGGACTGGAGCGA*CGGGGAGACCTACACCTGC
pigca_1159.z1       : CCGAGCCCGAGCCCAA*GGCCCCCGCCTCC*TACTTCGTGCAGAGC*GTCCTGACGGTGAGC*GCCAAGGACTGGAGCGA*CGGGGAGACCTACACCTGC
rpigca0_005101.y1   : CCGAGCCCGAGCCCAA*GGCCCCCGCCTCC*TACTTCGTGCAGAGC*GTCCTGACGGTGAGC*GCCAAGGACTGGAGCGA*CGGGGAGACCTACACCTGC
rcsp23b_m20.y1      : CCGAGCCCGAGCCCAA*GGCCCCCGCCTCC*TACTTGGTGCAGAGC*GTCCTGACGGTGAGC*GCCAAGGACTGGAGCGA*CGGGGAGACCTACACCTGC
rnlu1812b_a14.y1    : CCGAGCCCGAGCCCAA*GGCCCCcGGCTCC*TACTTCGTGCAGAGC*GTCCTGACGGTGAGC*GCCAAGGACTGGAGCGA*CGGGGAGACCTACACCTGC
rcly10b_c15.y1      : CCGAGCCCGAGCCCAA*GGCCCCCGCCTCC*TACTTCGTGCAGAGC*GTCCTGACGGTGAGC*GCCAAGGACTGGAGCGA*CGGGGAGACCTACACCTGC
rcsp30b_a22.y1      : CCGAGCCCGAGCCCAA*GGCCCCCGCCTCC*TACTTCGTGCAGAGC*GTCCTGACGGTGAGC*GCCAAGGACTGGAGCGA*CGGGGAGACCTACACCTGC
rcga35b_k8.y1       : CCGAGCCCGAGCCCAA*GGCCCCCGCCTCC*TACTTCGTGCAGAGC*GTCCTGACGGTGAGC*GCCAAGGACTGGAGCGA*CGGGGAGACCTACACCTGC
rcsp32b_a21.y1      : CCGAGCCCGAGCCCAA*GGCCCCCGCCTCC*TACTTCGTGCAGAGC*GTCCTGACGGTGAGC*GCCGGGGACTGGAGCGA*CGGGGAGACCTACACCTGC
rpigcb_10295.y1     : CCGAGCCCGAGCCCAA*GGCCCCCGCCTCC*TACTTCGTGCAGAGC*GTCCTGACGGTGAGC*GCCAAGGACTGGAGCGA*CGGGGAGACCTACACCTGC
rcly40b_m15.y1      : CCGAGCCCGAGCCCAA*GGCCCCCGCCTCC*TACTTCGTGCAGAGC*GTCCTGACGGTGAGC*GCCAAGGACTGGAGCGA*CGGGGAGACCTACACCTGC
rpigcb_15942.y1     : CCGAGCCCGAGCCCAA*GGCCCCCGCCTCC*TACTTCGTGCAGAGC*GTCCTGACGGTGAGC*GCCAAGGACTGGAGCGA*CGGGGAGACCTACACCTGC
rcsp25b_n22.y1      : CCGAGCCCGAGCCCAA*GGCCCCCGCCTCC*TACTTCGTGCAGAGC*GTCCTGACGGTGAGC*GCCAAGGACTGGAGCGA*CGGGGAGACCTACGCCTGC
rcad18b_p15.y1      : CCGAGCCCGAGCCCAA*GGCCCCCGCCTCC*TACTTCGTGCAGAGC*GTCCTGACGGTGAGC*GCCAAGGACTGGAGCGA*CGGGGAGACCTACACCTGC
rcsp16b_j14.y1      : CCGAGCCCGAGCCCAA*GGCCCCCGCCTCC*TACTTCGTGCAGAGC*GATCTGACGGTGAGC*GCCAAGGACTGGAGCGA*CGGGGAGACCTACAGCTGC
rcsp18b_h16.y1      : CCGAGCCCGAGCCCAA*GGCCCCCGCCTCC*TACTTCGTGCAGAGC*GTCCTGACGGTGAGC*GCCAAGGACTGGAGCGA*CGGGGAGACCTACACCTGC
rcly08b_p10.y1      : CCGAGCCCGAGCCCAA*GGCCCCCGCCTCC*TACTTCGTGCAGAGC*GTCCTGACGGTGAGC*GCCAAGGACTGGAGCGA*CGGGGAGACCTACACCTGC
rcsp17b_f13.y1      : CCGAGCCCGAGCCCAA*GGCCCCCGCCTCC*TACTTCGTGCAGAGC*GTCCTGACGGTGAGC*GCCAAGGACTGGAGCGA*CGGGGAGACCTACACCTGC
rcsp32b_a20.y1      : CCGAGCCCGAGCCCAA*GGCCCCCGCCTCC*TACTTCGTGCAGAGC*GTCCTGACGGTGAGC*GCCAAGGACTGGAGCGA*CGGGGAGACCTACACCTGC
rcga18b_m17.y1      : CCGAGCCCGAGCCCAA*GGCCCCCGCCTCC*TACTTCGTGCAGAGC*GTCCTGACGGTGAGC*GCCAAGGACTGGAGCGA*CGGGGAGACCTACACCTGC
rcad27b_b2.y1       : CCGAGCCCGAGCCCAA*GGCCCCCGCCTCC*TACTTCGTGCAGAGC*GTCCTGACGGTGAGC*GCCAAGGACTGGAGCGA*CGGGGAGACCTACACCTGC
rcad14b_l13.y1      : CCGAGCCCGAGCCCAA*GGCCCCCGCCTCC*TACTTCGTGCAGAGC*GTCCTGACGGTGAGC*GCCAAGGACTGGAGCGA*CGGGGAGACCTACACCTGC
rcsp30b_f16.y1      : CCGAGCCCGAGCCCAA*GGCCCCCGCCTCC*TACTTCGTGCAGAGC*GTCCTGACGGTGAGC*GCCAAGGACTGGAGCGA*CGGGGAGACCTACACCTGC
rcsp16b_p12.y1      : CCGAGCCCGAGCCCAA*GGCCCCCGCCTCC*TACTTCGTGCAGAGC*GTCCTGACGGTGAGC*GCCAAGGACTGGAGCGA*CGGGGAGACCTACACCTGC
rcly24b_f16.y1      : CCGAGCCCGAGCCCAA*GGCCCCCGCCTCC*TACTTCGTGCAGAGC*GTCCTGACGGTGAGC*GCCAAGGACTGGAGCGA*CGGGGAGACCTACACCTGC
rcad22b_e5.y1       : CCGAGCCCGAGCCCAA*GGCCCCCGCCTCC*TACTTCGTGCAGAGC*GTCCTGACGGTGAGC*GCCAAGGACTGGAGCGA*CGGGGAGACCTACACCTGC
rcad16b_o7.y1       : CCGAGCCCGAGCCCAA*GGCCCCCGCCTCC*TACTTCGTGCAGAGC*GTCCTGACGGTGAGC*GCCAAGGACTGGAGCGA*CGGGGAGACCTACACCTGC
rcsp30b_d8.y1       : CCGAGCCCGAGCCCAA*GGCCCCCGCCTCC*TACTTCGTGCAGAGC*GTCCTGACGGTGAGC*GCCAAGGACTGGAGCGA*CGGGGAGACCTACACCTGC
rcly06b_c15.y1      : CCGAGCCCGAGCCCAA*GGCCCCCGCCTCC*TACTTCGTGCAGAGC*GTCCTGACGGTGAGC*GCCAAGGACTGGAGCGA*CGGGGAGACCTACACCTGC
rcsp36b_p23.y1      : CCGAGCCCGAGCCCAA*GGCCCCCGCCTCC*TACTTCGTGCAGAGC*GTCCTGACGGTGAGC*GCCAAGGACTGGAGCGA*CGGGGAGACCTACACCTGC
rcsp04b_c18.y1      : CCGAGCCCGAGCCCAA*GGCCCCCGCCTCC*TACTTCGTGCAGAGC*GTCCTGACGGTGAGC*GCCAAGGACTGGAGCGA*CGGGGAGACCTACACCTGC
rcga34b_o23.y1      : CCGAGCCCGAGCCCAA*GGCCCCCGCCTCC*TACTTCGTGCAGAGC*GTCCTGACGGTGAGC*GCCAAGGACTGGAGCGA*CGGGGAGACCTACACCTGC
rcsp34b_i18.y1      : CCGAGCCCGAGCCCAA*GGCCCCCGCCTCC*TACTTCGTGCAGAGC*GTCCTGACGGTGAGC*GCCAAGGACTGGAGCGA*CGGGGAGACCTACACCTGC
rcsp33b_k21.y1      : CCGAGCCCGAGCCCAA*GGCCCCCGCCTCC*TACTTCGTGCAGAGC*GTCCTGACGGTGAGC*GCCAAGGACTGGAGCGA*CGGGGAGACCTACACCTGC
rcsp03b_l15.y1      : CCGAGCCCGAGCCCAA*GGCCCCCGCCTCC*TACTTCGTGCAGAGC*GTCCTGACGGTGAGC*GCCAAGGACTGGAGCGA*CGGGGAGACCTACACCTGC
rcad26b_a12.y1      : CCGAGCCCGAGCCCAA*GGCCCCCGCCTCC*TACTTCGTGCAGAGC*GTCCTGACGGTGAGC*GCCAAGGACTGGAGCGA*CGGGGAGACCTACACCTGC
rcsp30b_d10.y1      : CCGAGCCCGAGCCCAG*GGCCCC*GCCTCC*TACTTCGTGCAGAGC*GTCCTGACGGTGAGC*GCCAAGGACTGGAGCGA*CGGGGAGACCTACACCTGC
rcsp08b_m13.y1      : CCGAGCCCGAGCCCAA*GGCCCCCGCCTCC*TACTTCGTGCAGAGC*GTCCTGACGGTGAGC*GCCAAGGACTGGAGCGA*CGGGGAGACCTACACCTGC
rcsp11b_k9.y1       : CCGAGCGCGAGCCCAA*GGCCCCCGCCTCC*TACTTCGTGCAGAGC*GTCCTGACGGTGAGC*GCCAAGGACTGGAGCGA*CGGGGAGACCTACACCTGC
rcsp24b_g4.y1       : CCGAGCCCGAGCCCAA*GGCCCCCGCCTCC*TACTTCGTGCAGAGC*GTCCTGACGGTGAGC*GCCAAGGACTGGAGCGA*CGGGGAGACCTACACCTGC
rcsp12b_m23.y1      : CCGAGCCCGAGCCCAAtGGCCCCCGCCGCCgTACTTCGTGCAGAGC*GTCCTGACGGTGAGC*GCCAAGGACTGGAGCGA*CGGGGAGACCTACACCTGC
rcsp17b_n7.y1       : CCGAGCCCGAGCCCAA*GGCCCCCGCCTCC*TACTTCGTGCAGAGC*GTCCTGACGGTGAGC*GCCAAGGACTGGAGCGA*CGGGGAGACCTACACCTGC
rcly06b_g1.y1       : ctGAGCCCGAGCCCAA*GGCCCCCGCCTCC*TACTTCGTGCAGAGCgGTCCTGACGGTGAGCtGCCAAGGACTGGAGCGAcCGGGGAGACCTACACCTGC
rcsp09b_h4.y1       : ctGAGCCCGAGCCCAA*GGCCCCCGCCTCC*TACTTCGTGCAGAGC*GTCCTGACGGTGAGC*GCCAAGGACTGGAGCGA*CGGGGAGACCTACACCTGC
rcsp27b_e20.y1      : ----GCCCGAGCCCAA*GGCCCCCGCCTCC*TACTTCGTGCAGAGC*GTCCTGACGGTGAGC*GCCAAGGACTGGAGCGA*CGGGGAGACCTACACCTGC
rcsp11b_l20.y1      : -----------------GGCCCCCGCCTCC*TACTTCGTGCAGAGC*GTCCTGACGGTGAGC*GCCAAGGACTGGAGCGA*CGGGGAGACCTACACCTGC
rcly15b_n13.y1      : -------------------------gcagg*aattcggccgaggGC*GTACTGACGGTGAGC*GCCAAGGACTGGAGCGA*CGGGGAGACCTACACCTGC
rcsp40b_g8.y1       : ----------------------------------TTCGTGCAGAGC*GTCCTGACGGTGAGC*GCCAAGGACTGGAGCGA*CGGGGAGAGCGACACCTGC
rcsp23b_m12.y1      : ----------------------------------------CAGAGC*GTCCTGACGGTGAGC*GCCAAGGACTGGAGCGA*CGGGGAGACCGTGGCCTGC
rcsp33b_e9.y1       : --------------------------------------------------CTGACGGTGAGC*GCCAAGGACTGGAGCGA*CGGGGAGACCTACACCTGG
rcsp03b_k11.y1      : -------------------------------------------------------------c*gaggAGGACTGGAGCGA*CGGGGAGACCTACACCTGC
rcsp09b_a12.y1      : ------------------------------------------------------------------------TGGAGCGA*CGGGGAGACCTACACCTGC
rcad18b_l16.y1      : ------------------------------------------------------------------------TGGAGCGA*CGGGGAGACCTACACCTGC
rjej18b_e9.y1       : -------------------------------------------------------------------------ggcACGA*GGGGGAGACCTACACCTGC
rpigca_0210.y1      : ------------------------------------------------------------------------TGGAGCGA*CGGGGAGACCTACACCTGC
rcsp20b_m11.y1      : -------------------------------------------------------------------------ggaattc*ggcacgaggCTACACCTGC
rcsp34b_m13.y1      : -------------------------------------------------------------------------GGAGCGA*CGGGGAGACCTACACCTGC
rcsp30b_i11.y1      : ----------------------------------------------------------------------------------GGGGAGACCTACACCTGC
rcsp11b_k4.y1       : -------------------------------------------------------------------------------------GAGGCCTACACCTGC
rcsp05b_o23.y1      : -------------------------------------------------------------------------------------GAGGCCTACACCTGC
rcbl0_016523.y1     : ------------------------------------------------------------------------------------ggaattcggcacgagG
rcsp33b_n9.y1       : ----------------------------------------------------------------------------------------------------
rcsp33b_h22.y1      : ----------------------------------------------------------------------------------------------------
rcga28b_j17.y1      : ----------------------------------------------------------------------------------------------------
rcsp38b_k11.y1      : ----------------------------------------------------------------------------------------------------
rcly38b_h2.y1       : ----------------------------------------------------------------------------------------------------
rcad09b_b15.y1      : ----------------------------------------------------------------------------------------------------
rcsp19b_i2.y1       : ----------------------------------------------------------------------------------------------------
rcsp05b_l15.y1      : ----------------------------------------------------------------------------------------------------
rcad10b_g8.y1       : ----------------------------------------------------------------------------------------------------

--------------------------------------------------------------------------------------------------------------------------
BGISUSX0002000557   : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*GAGA*GGACC*G*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*CGTCT
rlnt17c_a6.y1       : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*GAGA*GGACC*G*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*CGTCT
rmcp28c_i21.y1      : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*GAGA*GGACC*G*TGGAC*AAGTCCA*CC*GGT*AAACC*ACCCTGTACAA*CGTCT
rcsp27b_n11.y1      : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*GAGA*GGACC*G*TGGAC*AAGTCCA*CC*GGT*AAACCCAC---------------
rcsp24b_d24.y1      : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*GAGA*GGACC*G*TGGAC*AAGTCCA*CC*GGT*AA---------------------
rcsp29b_d11.y1      : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*GAGA*GGACC*G*TGGACaAAGTCCA*CC*GGT*A----------------------
rcsp26b_o20.y1      : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*GAGA*GGACC*G*TGGAC*AAGTCCA*CC*GGT*AACACcACCCTGTACAA*CGTCT
rcst19_l24.y1       : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*GAGA*GGACC*G*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*CGTCT
rspl31_m12.y1       : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*GAGA*GGACC*G*TGGAC*AAGTCCA*CC*GGT*AAACCcAGCCTGTACAA*CGTCT
rcsp16b_h18.y1      : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*GAGA*GGACC*G*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*CGTCT
rsin04_e6.y1        : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*GAGA*GGACC*G*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*CGTCT
rcsp21b_o3.y1       : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*GAGA*GGACC*G*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*CGTCT
rcsp07b_n20.y1      : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*GAGA*GGACCtG*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*CGTCT
rcsp12b_d24.y1      : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*GAGA*GGACC*G*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*CGTCT
rcsp39b_j19.y1      : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*GAGA*GGACC*G*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*CGTCT
pigca_1159.z1       : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*GAGA*GGACC*G*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*CGTCT
rpigca0_005101.y1   : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*GAGA*GGACC*G*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*CGTCT
rcsp23b_m20.y1      : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*GAGA*GGACC*G*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*CGTCT
rnlu1812b_a14.y1    : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*GAGA*GGACC*G*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*CGTCT
rcly10b_c15.y1      : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*G--------------------------------------------------------
rcsp30b_a22.y1      : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*GAGA*GGACC*G*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*CGTCT
rcga35b_k8.y1       : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*GAGA*GGACC*G*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*CGTCT
rcsp32b_a21.y1      : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*GAGA*GGACC*G*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*CGTCT
rpigcb_10295.y1     : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*GAGA*GGACC*----------------------------------------------
rcly40b_m15.y1      : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*GAGA*GGACC*G*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*CGTCT
rpigcb_15942.y1     : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*GAGA*GGACC*G*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*CGTCT
rcsp25b_n22.y1      : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*GAGA*GGACC*G*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*CGTCT
rcad18b_p15.y1      : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*GAGA*GGACC*G*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*CGTCT
rcsp16b_j14.y1      : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*GAGA*GGACC*G*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*CGTCT
rcsp18b_h16.y1      : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*GAGA*GGACC*G*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*CGTCT
rcly08b_p10.y1      : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*GAG------------------------------------------------------
rcsp17b_f13.y1      : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*GAGA*GGACC*G*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*CGTCT
rcsp32b_a20.y1      : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*GAGA*GGACC*G*TGGAC*AAGTCCA*CC*GGTtAAACCCACCCTGTACAA*CGTC-
rcga18b_m17.y1      : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*GAGA*GGACC*G*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*CGTCT
rcad27b_b2.y1       : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*GAGA-----------------------------------------------------
rcad14b_l13.y1      : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*GAGA*GGACC*G*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*CGTCT
rcsp30b_f16.y1      : GT*CGTGG*GCCACGAGGCCCTGC**CCC*AGAC*GGTGACC*GAGA*GGACC*G*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*CGTCT
rcsp16b_p12.y1      : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACGG*GGTGACC*GAGA*GGACC*G*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*CGTCT
rcly24b_f16.y1      : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*GAGA*GGACC*G*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*CGTCT
rcad22b_e5.y1       : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*GAGA*----------------------------------------------------
rcad16b_o7.y1       : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*GAGA*GGACC*G*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*CGTCT
rcsp30b_d8.y1       : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*GAGA*GGACC*G*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*CGTCT
rcly06b_c15.y1      : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*GAGA*GGACC*G*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*CGTCT
rcsp36b_p23.y1      : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*GAGA*GGACC*G*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*CGTCT
rcsp04b_c18.y1      : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*GAGA*GGACC*GaTGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*CGTCT
rcga34b_o23.y1      : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*GAGA*GGACC*G*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*CGTCT
rcsp34b_i18.y1      : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*GAGA*GGGGC*G*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*CGTCT
rcsp33b_k21.y1      : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*GAGA*GGACC*G*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGGACAA*CGTCT
rcsp03b_l15.y1      : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*GAGA*GGACC*G*TGGAC*AAGTCCA*GC*GGT*AAACCCACCCTGTACAA*CGTCT
rcad26b_a12.y1      : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*GAGA*GGACC*G*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*CGTCT
rcsp30b_d10.y1      : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*GAGA*GGACC*G*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*CGTCT
rcsp08b_m13.y1      : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*GAGA*GGACC*G*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*CGTCT
rcsp11b_k9.y1       : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*GAGA*GGACC*G*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*C----
rcsp24b_g4.y1       : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*GAGA*GGACC*G*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*CGTCT
rcsp12b_m23.y1      : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*GAGA*GGACC*G*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*CGTCT
rcsp17b_n7.y1       : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*GAGA*GGACC*G*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*CGTCT
rcly06b_g1.y1       : GTnCGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*GAGA*GGACC*G*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*CGTCT
rcsp09b_h4.y1       : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*GAGA*GGACC*G*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*CGTCT
rcsp27b_e20.y1      : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*GAGA*GGACC*G*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*CGTCT
rcsp11b_l20.y1      : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*GAGA*GGACC*G*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*CGTCT
rcly15b_n13.y1      : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*GAGA*GGACC*G*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*CGTCT
rcsp40b_g8.y1       : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*GAGA*GGACC*G*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*CGTCT
rcsp23b_m12.y1      : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*GAGA*GGACC*G*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*CGTCT
rcsp33b_e9.y1       : GT*CGTGGtGCCACGAGGCCCTGC**CCC*ACACtGGTGACC*GAGA*GGACC*G*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*CGTCT
rcsp03b_k11.y1      : GT*CGTGGtGCCAGGAGGCCCTGC**CCC*ACAC*GGTGACCtGAGA*GGACCtG*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*CGTCT
rcsp09b_a12.y1      : GT*CGTGG*GCCACGAGGCCCTGC**CCCgACAC*GGTGACC*GAGA*GGACC*G*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*CGTCT
rcad18b_l16.y1      : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACCtGAGA*GGACC*G*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*CGTCT
rjej18b_e9.y1       : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*GAGA*GGACC*G*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*CGTCT
rpigca_0210.y1      : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACCtGAGA*GGACCtG*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*CGTCT
rcsp20b_m11.y1      : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*GAGAaGGAGC*G*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*CGTCT
rcsp34b_m13.y1      : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*GAGA*GGACC*G*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*CGTCT
rcsp30b_i11.y1      : GT*CGTGG*GCCACGAGGCCCTGcggCCC*ACAC*GGTGACCtGAGA*GGACC*G*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*CGTCT
rcsp11b_k4.y1       : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACCtGAGA*GGAGC*G*TGGAC*AAGTCCA*CCtGGT*AAACCCACCCTGTACAA*CGTCT
rcsp05b_o23.y1      : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*GAGA*GGGGC*G*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*CGTCT
rcbl0_016523.y1     : GT*CGTGG*GCCACGAGGCCCTGC**CCC*ACAC*GGTGACC*GAGA*GGACC*G*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*CGTCT
rcsp33b_n9.y1       : -----------CACGAGGCC*TG***CCC*ACAC*GGTGACC*GAGA*GGACC*G*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*CGTCT
rcsp33b_h22.y1      : --------------------CTGC**CCC*ACAC*GGTGACC*GAGA*GGACC*G*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*CGTCT
rcga28b_j17.y1      : ----------------------GC**CCC*ACAC*GGTGACC*GAGA*GGACC*G*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTAGAG*GGTCT
rcsp38b_k11.y1      : --------------------------------------cacg*agGA*GGACC*G*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*CGTCT
rcly38b_h2.y1       : ---------------------------------------atc*ggca*cgagg*g*tGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*CGTCT
rcad09b_b15.y1      : -----------------------------------------C*GAGA*GGACC*G*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAAgCGTCT
rcsp19b_i2.y1       : ---------------------------------------------------ct*G*TGGAC*AAGTCCAcCC*GGT*AAACCCACCCTGTACAA*CGTCT
rcsp05b_l15.y1      : ------------------------------------------------------G*TGGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*CGTCT
rcad10b_g8.y1       : ---------------------------------------------------------GGAC*AAGTCCA*CC*GGT*AAACCCACCCTGTACAA*CGTCT

------------------------------------------------------------------
BGISUSX0002000557   : CCCT*G*GT*CCTGTC*C*GACACGGCCAGCACC*TGCTACTGA
rlnt17c_a6.y1       : CCCT----------------------------------------
rmcp28c_i21.y1      : CCC-----------------------------------------
rcsp27b_n11.y1      : --------------------------------------------
rcsp24b_d24.y1      : --------------------------------------------
rcsp29b_d11.y1      : --------------------------------------------
rcsp26b_o20.y1      : CCCT----------------------------------------
rcst19_l24.y1       : CCCT----------------------------------------
rspl31_m12.y1       : CCCT----------------------------------------
rcsp16b_h18.y1      : CCCTt---------------------------------------
rsin04_e6.y1        : CCCT----------------------------------------
rcsp21b_o3.y1       : CCCT*---------------------------------------
rcsp07b_n20.y1      : CCCT*G*G------------------------------------
rcsp12b_d24.y1      : CCCT----------------------------------------
rcsp39b_j19.y1      : CCCT----------------------------------------
pigca_1159.z1       : CCCT----------------------------------------
rpigca0_005101.y1   : CCCT*---------------------------------------
rcsp23b_m20.y1      : CCCT----------------------------------------
rnlu1812b_a14.y1    : CCCT----------------------------------------
rcly10b_c15.y1      : --------------------------------------------
rcsp30b_a22.y1      : CCCT*G*-------------------------------------
rcga35b_k8.y1       : CCCT*G*GT-----------------------------------
rcsp32b_a21.y1      : CCCT*G*GT-----------------------------------
rpigcb_10295.y1     : --------------------------------------------
rcly40b_m15.y1      : CCCT*G*G------------------------------------
rpigcb_15942.y1     : CCCT*G*-------------------------------------
rcsp25b_n22.y1      : CCCT*G*-------------------------------------
rcad18b_p15.y1      : CCCT*G*-------------------------------------
rcsp16b_j14.y1      : CCCT*G*-------------------------------------
rcsp18b_h16.y1      : CCCT*G*GT-----------------------------------
rcly08b_p10.y1      : --------------------------------------------
rcsp17b_f13.y1      : CCCT*G*GT-----------------------------------
rcsp32b_a20.y1      : --------------------------------------------
rcga18b_m17.y1      : CCCT*G*G------------------------------------
rcad27b_b2.y1       : --------------------------------------------
rcad14b_l13.y1      : CCCT*G*GT*CCT-------------------------------
rcsp30b_f16.y1      : CCCT*G*GT*C---------------------------------
rcsp16b_p12.y1      : CCCT*G*GT*C---------------------------------
rcly24b_f16.y1      : CCCT*G*GT*----------------------------------
rcad22b_e5.y1       : --------------------------------------------
rcad16b_o7.y1       : CCCT*G*GT*----------------------------------
rcsp30b_d8.y1       : CCCT*G*GT-----------------------------------
rcly06b_c15.y1      : CCCT*G*GT*----------------------------------
rcsp36b_p23.y1      : CACT*G*GT*C---------------------------------
rcsp04b_c18.y1      : CCCT*G*GT*CCTG------------------------------
rcga34b_o23.y1      : CCCT*G*-------------------------------------
rcsp34b_i18.y1      : CCCT*G*GT*CCTGT-----------------------------
rcsp33b_k21.y1      : CCCT*G*GT*CC--------------------------------
rcsp03b_l15.y1      : CCCT*G*GT*CC--------------------------------
rcad26b_a12.y1      : CCCT*G*GT*CC--------------------------------
rcsp30b_d10.y1      : CCCT*G*GT-----------------------------------
rcsp08b_m13.y1      : CCCT*G*GT*CCTG------------------------------
rcsp11b_k9.y1       : --------------------------------------------
rcsp24b_g4.y1       : CCCT*G*GT*CCTGTC----------------------------
rcsp12b_m23.y1      : CCCT*G*GT*CCTGTC*C--------------------------
rcsp17b_n7.y1       : CCCT*G*GT*CCTGTC----------------------------
rcly06b_g1.y1       : CCCT*G*GT*CCTGTC*C*GACA---------------------
rcsp09b_h4.y1       : CCCT*G*GT*CCTGTC*C*-------------------------
rcsp27b_e20.y1      : CCCT*G*GT*CCGGTC*C*G------------------------
rcsp11b_l20.y1      : CCCT*G*GT*CCTGTC*C*GA-----------------------
rcly15b_n13.y1      : CCCT*G*GT*CCTGTC*C*GA-----------------------
rcsp40b_g8.y1       : CCCT*G*GT*CCTGTC*C*GAC----------------------
rcsp23b_m12.y1      : CCCT*G*GT*CCTGTC*C*GAC----------------------
rcsp33b_e9.y1       : CCCT*G*GT*CCTGTC*C*GACACG-------------------
rcsp03b_k11.y1      : CCCT*G*GT*CCTGTC*C*GACACGG------------------
rcsp09b_a12.y1      : CCCT*GtGT*CCTGTC*C*GACACGG------------------
rcad18b_l16.y1      : CCCT*G*GT*CCTGTC*C*GACACG-------------------
rjej18b_e9.y1       : CCCT*GtGT*CCTGTC*C*GACACG-------------------
rpigca_0210.y1      : CCCT*G*GT*CCTGTC*C*GACACGG------------------
rcsp20b_m11.y1      : CCCT*G*GT*CCTGTC*C*GACACG-------------------
rcsp34b_m13.y1      : CCCT*G*GT*CCTGTC*C*GACAC--------------------
rcsp30b_i11.y1      : CCCT*G*GT*CCTGTC*C*GACACGGCC----------------
rcsp11b_k4.y1       : CCCT*G*GT*CCTGTC*C*GACACGGC-----------------
rcsp05b_o23.y1      : CCCT*GtGT*CCTGTC*C*GACACGG------------------
rcbl0_016523.y1     : CCCT*G*GT*CCTGTC*C*GACACG-------------------
rcsp33b_n9.y1       : CCCT*T*GT*CCTGTC*C*GACACG-------------------
rcsp33b_h22.y1      : CCCT*G*GT*CCTGTC*C*GACACGGC-----------------
rcga28b_j17.y1      : CCCT*G*GTtCCTGTC*C*GACACGGCC----------------
rcsp38b_k11.y1      : CCCT*G*GT*CCTGTC*C*GACACGGCCAGC-------------
rcly38b_h2.y1       : CCCT*G*GT*CCTGTC*C*GACGCGGCCAGC-------------
rcad09b_b15.y1      : CCCT*G*GT*CCTGTC*C*GACACGGCCAGCA------------
rcsp19b_i2.y1       : CCCT*G*GT*CCTGTC*C*GACACGGCCAGCACC----------
rcsp05b_l15.y1      : CCCT*G*GT*CCTGTCgCgGACACGGCCAGCACC*T--------
rcad10b_g8.y1       : CCCT*G*GT*CCTGTC*C*GACACGGCCAGCACC*---------

Cited by

ENST00000312636