Sequences

BGISUSX0002000677

Source Seq Type : est

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>BGISUSX0002000677
GAGGTCAAGGTGGTGGGTCTGGAGGGCTCGGACAAGCTCTCCATCCTTCGAGGCTGCCCGGGGCTGCCTGGAGCCACCGGGCCCAAGGGAGAGGCGGGCG
CCAATGGA

Assemble


--------------------------------------------------------------------------------------------------------------------------
BGISUSX0002000677   : GAGGTCAAGGTGGTGGGTCTGGAGGGCTCGGACAAGCTCTCCATCCTTCGAGGCTGCCCGGGGCTGCCTGGAGCCACCGGGCCCAAGGGAGAGGCGGGCG
reje12b_a4.y1       : GAGGTCAAGGTGGTGGGTCTGGAGGGCTCGGACAAGCTCTCCATCCTCCGAGGCTGCCCGGGGCTGCCTGGAGCCGCAGGGCCCAAGGGAGAGGCGGGCG
rcsp23b_e23.y1      : GAGGTCAAGGTGGTGGGTCTGGAGGGCTCAGACAAGCTCTCCATCCTCCGAGGCTGCCCGGGGCTGCCTGGAGCCGCAGGGCCCAAGGGAGAGGCGGGCG
rmed05c_f10.y1      : GAGGTCAAGGTGGTGGGTCTGGAGGGCTCGGACAAGCTCTCCATCCTTCGAGGCTGCCCGGGGCTGCCTGGAGCCACCGGGCCCAAGGGAGAGGCGGGCG

------------------------------
BGISUSX0002000677   : CCAATGGA
reje12b_a4.y1       : CCGATGGa
rcsp23b_e23.y1      : CCAATGGa
rmed05c_f10.y1      : CCAATGGa

Cited by

ENST00000223427