Sequences

BGISUSX0002000861

Source Seq Type : est

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>BGISUSX0002000861
GGTGTTTACGTTTGGGATGTAGAAGGCAGGAGATACTTCGACTTCCTGAGTGCCTACAGCGCTGTGAACCAAGGGCACTGCCACCCAAAGATCGTGAACG
CTCTGAAACGTCAGGTGGACAAACTGACCCTGACGTCGAGGGCTTTCTACAATGACGTGCTCGGGGAATACGAAGAGTACATTACGAAGCTTTTCAACTA
CCACAAGGTCCTGCCTATGAATACA

Assemble


--------------------------------------------------------------------------------------------------------------------------
BGISUSX0002000861   : GGTGTTTACGTTTGGGATGTAG*AA*GGCAGGAGATACTTCGACTTCCTGAGTGCCTACAGCGCTGTGAACCAAGGGCACTGCCACCCAAAGATCGTGAA
rnje19c_b13.y1      : GGTGTTTACGTTTGGGATGTAGaAAaGGCAGGAGATACTTCGACTTCCTGAGTGCCTACAGCGCTGTGAACCAAGGGCACTGCCACCCAAAGATCGTGAA
rnje19c_b6.y1       : GGTGTTTACGTTTGGGATGTAG*AA*GGCAGGAGATACTTCGACTTCCTGAGTGCCTACAGCGCTGTGAACCAAGGGCACTGCCACCCAAAGATCGTGAA
rnje18c_d21.y1      : GGTGTTTACGTTTGGGATGTAG*AA*GGCAGGAGATACTTCGACTTCCTGAGTGCCTACAGCGCTGTGAACCAAGGGCACTGCCACCCAAAGATCGTGAA
rnje28c_a5.y1       : GGTGTTTACGTTTGGGATGTAG*AA*GGCAGGAGATACTTCGACTTCCTGAGTGCCTACAGCGCTGTGAACCAAGGGCACTGCCACCCAAAGATCGTGAA
reje27b_p10.y1      : GGTGTTTACGTTTGGGATGTAG*AA*GGCAGGAGATACTTCGACTTCCTGAGTGCCTACAGCGCTGTGAACCAAGGGCACTGCCACCCAAAGATCGTGAA
reje07b_p12.y1      : GGTGTTTACGTTTGGGATGTAG*AA*GGCAGGAGATACTTCGACTTCCTGAGTGCCTACAGCGCTGTGAACCAAGGGCACTGCCACCCAAAGAT------
rnje03c_l3.y1       : GGTGTTTACGTTTGGGATGTAG*AA*GGCAGGAGATACTTCGACTTCCTGAGTGCCTACAGCGCTGTGAACCAAGGGCACTGCCACCCAAAGATCGTGAA
rnje16c_d2.y1       : GGTGTTTACGTTTGGGATGTAG*AA*GGCAGGAGATACTTCGACTTCCTGAGTGCCTACAGCGCTGTGAACCAAGGGCACTGCCACCCAAAGATCGTGAA
reje29b_d24.y1      : GGTGTTTACGTTTGGGATGTAG*AA*GGCAGGAGATACTTCGACTTCCTGAGTGCCTACAGCGCTGTGAACCAAGGGCACTGCCACCCAAAGATCGTGAA
reru13c_o3.y1       : GGTGTTTACGTTTGGGATGTAG*AA*GGCAGGAGATACTTCGACTTCCTGAGTGCCTACAGCGCTGTGAACCAAGGGCACTGCCACCCAAAGATCGTGAA
rnco1924b_d13.y1    : GGTGTTTACGTTTGGGATGTAG*AA*GGCAGGAGATACTTCGACTTCCTGAGTGCCTACAGCGCTGTGAACCAAGGGCACTGCCACCCAAAGATCGTGAA
rplac_8447.y1       : GGTGTTTACGTTTGGGATGTAG*AA*GGCAGGAGATACTTCGACTTCCTGAGTGCCTACAGCGCTGTGAACCAAGGGCACTGCCACCCAAAGATCGTGAA
rnje08c_l4.y1       : GGTGTATACGTTTGGGATGTAG*AA*GGCAGGAGATACTTCGACTTCCTGAGTGCCTACAGCGCTGTGAACCAAGGGCACTGCCACCCAAAGATCGTGAA
rjej31b_b22.y1      : GGTGTTTACGTTTGGGATGTAG*AA*GGCAGGAGATACTTCGACTTCCTGAGTGCCTACAGCGCTGTGAACCAAGGGCACTGCCACCCAAAGATCGTGAA
reje34b_e21.y1      : ----------------------------------------------------------------------------------------------------
rcje39_e2.y1        : ----------------------------------------------------------------------------------------------------
rnco1905b_e24.y1    : ----------------------------------------------------------------------------------------------------

--------------------------------------------------------------------------------------------------------------------------
BGISUSX0002000861   : CGCTCTGAAACGTCAGGTGGACAAACTGACCCTGACGTCGAGGGCTTTCTACAATGACGTGCTCGGGGAATACGAAGAGTACATTACGAAGCTTTTCAAC
rnje19c_b13.y1      : CGCTCTGAAACGTCAGGTGGACAAACTGACCCTGACGTCGAGGGCTTTCTACAATGATGTGCTCGGGGAATACGAAGAGTACATTACGAAGCTTTTCAAC
rnje19c_b6.y1       : CGCTCTGAA-------------------------------------------------------------------------------------------
rnje18c_d21.y1      : CGCTCTGAAACGTCAGGTGGACAAACTGACCCTGACGTCGAGGGCTTTCTACAATGATGTGCTCGGGGAATACGAAGAGTACATTACGAAGCTTTTCAAC
rnje28c_a5.y1       : CGCTCTGAAACGTCAGGTGGACAAACTGACCCTGACGTCGAGGGCTTTCTACAATGATGTGCTCGGGGAATACGAAGAGTACATTACGAAGCTTTTCAAC
reje27b_p10.y1      : CGCTCTGAAACGTCAGGTGGACAAACTGACCCTGACGTCGAGGGCTTTCTACAATGATGTGCTCGGGGAATACGAAGAGTACATTACGAAGCTTTTCAAC
reje07b_p12.y1      : ----------------------------------------------------------------------------------------------------
rnje03c_l3.y1       : CGCTCTGAAACGTCAGGTGGACAAACTGACCCTGACGTCGAGGGCTTTCTACAATGATGTGCTCGGGGAATACGAAGAGTACATTACGAAGCTTTTCAAC
rnje16c_d2.y1       : CGCTCTGAAACGTCAGGTGGACAAACTGACCCTGACGTCGAGGGCTTTCTACAATGACGTGCTCGGGGAATACGAAGAGTACATTACGAAGCTTTTCAAC
reje29b_d24.y1      : CGCTCTGAAACGTCAGGTGGACAAACTGACCCTGACGTCGAGGGCTTTCTACAATGACGTGCTCGGGGAATACGAGGAGTACATTACGAAGCTTTTCAAC
reru13c_o3.y1       : CGCTCTGAAACGTCAGGTGGACAAACTGACCCTGACGTCGAGGGCTTTCTACAATGACGTGCTCGGGGAATACGAAGAGTACATTACGAAGCTTTTCAAC
rnco1924b_d13.y1    : CGCTCTGAAACGTCAGGTGGACAAACTGACCCTGACGTCGAGGGCTTTCTACAATGACGTGCTCGGGGAATACGAAGAGTACATTACGAAGCTTTTCAAC
rplac_8447.y1       : CGCTCTGAAACGTCAGGTGGACAAACTGACCCTGACGTCGAGGGCTTTCTACAATGACGTGCTCGGGGAATACGAAGAGTACATTACGAAGCTTTTCAA-
rnje08c_l4.y1       : CGCTCTGAAACGTCAGGTGGACAAACTGACCCTGACGTCGAGGGCTTTCTACAATGACGTGCTCGGGGAATACGAAGAGTACATTACGAAGCTT------
rjej31b_b22.y1      : CGCTCTGAAACGTCAGGTGGACAAACTGACCCTGACGTCGAGGGCTTTCTACAATGACGTGCTCGGGGAATACGAAGAGTACATTACGAAGCTTTTCAAC
reje34b_e21.y1      : --------------------------TGACCCTGACGTCGAGGGCTTTCTACAATGATGTGCTCGGGGAATACGAAGAGTACATTACGAAGCTTTTCAAC
rcje39_e2.y1        : --------------------------------------------------------ACGTGCTCGGGGAATACGAAGAGTACATTACGAAGCTTTTCAAC
rnco1905b_e24.y1    : ----------------------------------------------------------gcacgAGGGGAATACGAAGAGTACATTACGAAGCTTTTCAAC

-------------------------------------------------
BGISUSX0002000861   : TACCACAAGGTCCTGCCTATGAATACA
rnje19c_b13.y1      : TACCACAAGGTCCTGCCTATGAATACa
rnje19c_b6.y1       : ---------------------------
rnje18c_d21.y1      : TACCACAAGGTCCTGCCTATGAATA--
rnje28c_a5.y1       : TACCACAAGGTCCTGCCTAT-------
reje27b_p10.y1      : TACCACA--------------------
reje07b_p12.y1      : ---------------------------
rnje03c_l3.y1       : TACCACAAGGTCCTGCCTATGAATACA
rnje16c_d2.y1       : TACCACAAGGTCCTGCCTATGAATA--
reje29b_d24.y1      : TACCACAAGGTCCTGCCTATGAATACA
reru13c_o3.y1       : TACCACAAGGTCCTGCCTA--------
rnco1924b_d13.y1    : TACCACAAGGTCCTGCCTATGAATACA
rplac_8447.y1       : ---------------------------
rnje08c_l4.y1       : ---------------------------
rjej31b_b22.y1      : TACCA----------------------
reje34b_e21.y1      : TACCACAAGGTCCTGCCTATGAATACa
rcje39_e2.y1        : TACCACAAGGTCCTGCCGATGAATACa
rnco1905b_e24.y1    : TACCACAAGGTCCTGCCTATGAATACa

Cited by

ENST00000224242