Sequences

BGISUSX0002000880

Source Seq Type : est

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>BGISUSX0002000880
GATTACGACGCTTGGAAGGTGTGTCTGCGACTTCGAGATAATGGACTTCTGGCCAAGCCAACCCACGGCGATATCATCAGATTTGCGCCTCCGCTTGTGA
TCAAGTAGGATGAGATTCTGGAGTCGGTGGAAATCATTAACAAGACCGTCTTGTCTTTCTGA

Assemble


--------------------------------------------------------------------------------------------------------------------------
BGISUSX0002000880   : GATTACGACGCTTG*GAAGGTGTGTCTGCGACTTCGAGA*TAATGGACT*TCTGGCCAAGCCAACCCAC*GGCGA*TATCATCAGATTTGC*GCCTCCGC
rpigcf0_012803.y1   : GATTACGACGCTTG*GAAGGTGTGTCTGCGACTTCGAGA*TAATGGACTaTCTGGCCAAGCCAACCCAC*GGCGA*TATCATCAGATTaGC*GCCTCCGC
rpliv0125_p16.y1    : GATTACGATGCTTGtGAAGGTGTGTCTGCGACTTCGAGA*TAATGGACT*TCTGGCCAAGCCAACCCAC*GGCGA*TATCATCAGATTTGC*GCCTCCGC
rnje10c_j19.y1      : GATTACGACGCTTG*GAAGGTGTGTCTGCGACTTCGAGAaTAATGGACT*TCTGGCCAAGCCAACCCAC*GGCGA*TATCATCAGATTTGC*GCCTCCGC
rplun0126_i24.y1    : GATTACGACGCTTG*GAAGGTGTGTCTGCGACTTCGAGA*TAATGGACT*TCTGGCCAAGCCAACCCAC*GGCGA*TATCATCAGATTTGC*GCC-----
rcje33_j22.y1       : GATTACGACGCTTG*GAAGGTGTGTCTGCGACTTCGAGA*TAATGGACT*TCTGGCCAAGCCAACCCAC*GGCGA*TATCATCAGATTTGC*--------
rski0110_o17.y1     : GATTACGATGCTTG*GAAGGTGTGTCTGCGACTTCGAGA*TAATGGACT*TCTGGCCAAGCCAACCCAC*GGCGA*TATCATCAGATTTGC*GCCTCCGC
reje27b_b8.y1       : GATTACGACGCTTG*GAAGGTGTGTCTGCGACTTCGAGA*TAATGGACT*TCTGGCCAAGCCAACCCAC*GGCGA*TATCATCAGATTTGC*GCCTCCGC
rmgp015_h2.y1       : GATTACGACGCTTG*GAAGGTGTGTCTGCGACTTCGAGA*TAATGGACT*TCTGGCCAAGCCAACCCAC*GGCGA*TATCATCAGATTTGC*GCCTCCGC
rsin27_i24.y1       : GATTACGACGCTTG*GAAGGTGTGTCTGCGACTTCGAGA*TAATGGACT*TCTGGCCAAGCCAACCCAC*GGCGA*TATCATCAGATTTGC*GCCTCCGC
rsin27_o18.y1       : GATTACGACGCTTG*GAAGGTGTGTCTGCGACTTCGAGA*TAATGGACT*TCTGGCCAAGCCAACCCAC*GGCGA*TATCATCAGATTTGC*GCCTCCGC
rnje19c_c20.y1      : GATTACGACGCTTG*GAAGGTGTGTCTGCGACTTCGAGA*TAATGGACT*TCTGGCCAAGCCAACCCAC*GGCGA*TATCATCAGATTTGC*GCCTCCGC
rcut22_i7.y1        : GATTACGACGCTTG*GAAGGTGTGTCTGCGACTTCGAGA*TAAGGGACT*TCTGGCCAAGCCAACCCAC*GGCGA*TATCATCAGATTTGC*GCCTCCGC
rjej39b_n8.y1       : GATTACGACGCTTG*GAAGGTGTGTCTGCGACTTCGAGA*TAATGGACT*TCTGGCCAAGCCAACCCAC*GGCGA*TATCATCAGATTTGC*GCCTCCGC
rdbla0104_e16.y1    : -ATTACGACGCTTG*GAAGGTGTGTCTGCGACTTCGAGA*TAATGGACT*TCTGGCCAAGCCAACCCAC*GGCGA*TATCATCAGATTTGC*GCCTCCGC
rsin35_k13.y1       : --TTACGACGCTTG*GAAGGTGTGTCTGCGACTTCGAGA*TAATGGACT*TCTGGCCAAGCCAACCCAC*GGCGA*TATCATCAGATTTGC*GCCTCCGC
rpliv0115_a9.y1     : ----gGGACGCTTG*GAAGGTGTGTCTGCGACTTCGAGA*TAATGGACT*TCTGGCCAAGCCAACCCAC*GGCGA*TATCATCAGATTTGC*GCCTCCGC
rfat0125_j3.y1      : ----gagGCGCTTG*GAAGGTGTGTCTGCGACTTCGAGA*TAATGGACT*TCTGGCCAAGCCAACCCAC*GGCGA*TATCATCAGATTTGC*GCCTCCGC
recc2820c_e14.y1    : ------gaGGCTTG*GAAGGTGTGTCTGCGACTTCGAGA*TAATGGACT*TCTGGCCAAGCCAACCCAC*GGCGA*TATCATCAGATTTGC*GCCTCCGC
rcsk20_l14.y1       : ------gaGGCTTG*GAAGGTGTGTCTGCGACTTCGAGA*TAATGGACT*TCTGGCCAAGCCAACCCAC*GGCGAgTATCATCAGATTgGC*GCCTCCGC
rnje03c_j20.y1      : -------------G*GAAGGTGTGTCTGCGACTTCGAGA*TAATGGACT*TCTGGCCAAGCCAACCCAC*GGCGA*TATCATCAGATTTGC*GCCTCCGC
rsin14_m21.y1       : -------------------GTGTGTCTGCGACTTCGAGA*TACTGGACT*TCTGGCCAAGCCAACCCACtGGCGA*TATCATCAGATTtGCtGCCTCCGC
rcst34_l4.y1        : --------------------------TGCGACTTCGAGA*TAATGGACT*TCTGGCCAAGCCAACCCAC*GGCGA*TATCATCAGATTTGC*GCCTCCGC
rsme031_g21.y1      : -------------------------------cttcggaa*ttcggcacg*agggGCCAAGCCAACCCAC*GGCGA*TATCATCAGATTTGC*GCCTCCGC
rret27_k17.y1       : -----------------------------------GAGA*TAATGGACT*TCTGGCCAAGCCAACCCAC*GGCGA*TATCATCAGATTTGC*GCCTCCGC
rcbe03_n14.y1       : ----------------------------------------------------------------------GGCGA*TATCATCAGATTTGC*GCCTCCGC
rcje07_m5.y1        : ----------------------------------------------------------------------GGCGA*TATCATCAGATT*GC*GCCTCCGC
reje13b_k13.y1      : -----------------------------------------------------------------------------ATCATCAGATTTGC*GCCTCCGC
rsag09_j1.y1        : --------------------------------------------------------------------------------ATCAGATTTGC*GCCTCCGC

------------------------------------------------------------------------------------------
BGISUSX0002000880   : TTGTGATCAAGTAGGATGAGATTCTGGAGTCGGTGGAAATCATTAACAAGACCGTCTTGTCTTTCTGA
rpigcf0_012803.y1   : TTGTGATCAAGGAGGATGAGATTCTGGAGTCGGTGGAAATCATTAACAAGACCGTCTTGTCTTTC---
rpliv0125_p16.y1    : TTGTGATCAAGGAGGATGAGATTCTGGAGTCGGTGGAAATCATTAACAAGACCGTCTTGTCTTTC---
rnje10c_j19.y1      : TTGTGATCAAGGAGGATGAGATTCTGGAGTCGGTGGAAATCATTAACAAGACCGTCTTGTCTTTC---
rplun0126_i24.y1    : --------------------------------------------------------------------
rcje33_j22.y1       : --------------------------------------------------------------------
rski0110_o17.y1     : TTGTGATCAAGGAGGATGAGATTCTGGAGTCGGTGGAAATCATTAACAAGACCGTCTTGTCTTT----
reje27b_b8.y1       : TTGTGATCAAGTAGGATGAGATTCTGGAGTCGGTGGAAATCATTAACAAGACCGTCTTGTCTTT----
rmgp015_h2.y1       : TTGTGATCAAGGAGGATGAGATTCTGGAGTCGGTGG--------------------------------
rsin27_i24.y1       : TTGTGATCAAGGAGGATGAGATTCTGGAGTCGGTGGACATCATTAGCAAGACCGTCTTGTCTTT----
rsin27_o18.y1       : TTGTGATCAAGGAGGATGAGATTCTGGAGTCGGTGGAAATCATTAACAAGACCGTCTTGTCTTT----
rnje19c_c20.y1      : TTGTGATCAAGGAGGATGAGATTCTGGAGTCGGTGGAAATCATTAACAAGACCGTATtGTCTTT----
rcut22_i7.y1        : TTGTGATCAAGGAGGATGAGATTCTGGAGTCGGTGGAAATCATTAACAAGACCGTCTTGTCTTT----
rjej39b_n8.y1       : TTGTGATCAAGGAGGATGAGATTCTGGAGTCGGTGGAAATCATTAACAAGACCGTCTtGTC-------
rdbla0104_e16.y1    : TTGTGATCAAGGAGGATGAGATTCTGGAGTCGGTGGAAATCATTAACAAGACCGTCTTGTCTTT----
rsin35_k13.y1       : TTGTGATCAAGGAGGATGAGATTCTGGAGTCGGTGGAAATCATTAACAAGACCGTCTTGTCTTT----
rpliv0115_a9.y1     : TTGTGATCAAGGAGGATGAGATTCTGGAGTCGGTGGAAATCATTAACAAGACCGTCTTGTCTTT----
rfat0125_j3.y1      : TTGTGATCAAGGAGGATGAGATTCTGGAGTCGGTGGAAATCATTAACAAGACCGTCTTGTCTTT----
recc2820c_e14.y1    : TTGTGATCAAGGAGGATGAGATTCTGGAGTCGGTGGAAATCATTAACAAGACCGTCTTGTCTTT----
rcsk20_l14.y1       : TTGTGATCAAGGAGGATGAGATTCTGGAGTCGGTGGAAATCATTAACAAGACCGTCTaGTCTTTC---
rnje03c_j20.y1      : TTGTGATCAAGGAGGATGAGATTCTGGAGTCGGTGGAAATCATTAACAAGACCGTCTTGTCTTT----
rsin14_m21.y1       : TTGTGATCAAGGAGGATGAGATTCTGGAGTCGGTGGAAATCATTAACAAGACCGTCTTGTCTTTCTG-
rcst34_l4.y1        : TTGTGATCAAGGAGGATGAGATTCTGGAGTCGGTGGAAATCATTAACAAGACCGTCTTGTCTTTC---
rsme031_g21.y1      : TTGTGATCAAGGAGGATGAGATTCTGGAGTCGGTGGAAATCATTAACAAGACCGTCTTGTCTTTC---
rret27_k17.y1       : TTGTGATCAAGGAGGATGAGATTCTGGAGTCGGTGGAAATCATTAACAAGACCGTCTTGTCTTTC---
rcbe03_n14.y1       : TTGTGATCAAGGAGGATGAGATTCTGGAGTCGGTGGAAATCATTAACAAGACCGTCT*GTCTTTCTG-
rcje07_m5.y1        : TTGTGATCAAGGAGGATGAGATTCTGGAGTCGGTGGAAATCATTAACAAGACCGTCTTGTCTTTCTG-
reje13b_k13.y1      : TTGTGATCAAGGAGGATGAGATTCTGGAGTCGGTGGAAATCATTAACAAGACCGTCTTGTCTTTCTGA
rsag09_j1.y1        : TTGTGATCAAGGAGGATGAGATTCTGGAGTCGGGGGAAATCATTAACAAGACCGTCTTGTCTTTCTGA

Cited by

ENST00000224242