Sequences

BGISUSX0002000938

Source Seq Type : est

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>BGISUSX0002000938
GATGTGGAGAACAGCTTCTTTTTGAATGTCAACTCCCAAGTAACAACAGTGTGTCAGATTCTTGCTAAGGATCCTAAGTTACAACAAGGCTACAATGCTA
TGGGATTCTCCCAGGGCGGCCAATTT

Assemble


--------------------------------------------------------------------------------------------------------------------------
BGISUSX0002000938   : GATGTGGAGAACAGCTTCTTTTTGAATGTCAACTCCCAAGTAACAACAGTGTGTCAGATTCTTGCTAAGGATCCTAAGTTACAACAAGGCTACAATGCTA
rtra19_b19r1.y1     : GATGTGGAGAACAGCTTCTTTTTGAATGTCAACTCCCAAGTAACAACAGTGTGTCAGATTCTTGCTAAGGATCCTAAGTTACAACAAGGCTACAATGCTA
recc2813c_j14.y1    : GATGTGGAGAACAGCTTCTTTTGGAATGTCAACTCCCAAGTAAGAACAGTGTGTCAGATTCTGGCTAAGGATCCTAAGTTACAACAAGGTTACAAGGCTA
rcov32b_b19.y1      : GATGTGGAGAACAGCTTCTTTTTGAATGTCAACTCCCAAGTAACAACAGTGTGTCAGATTCTTGCTAAGGATCCTAAGTTACAGCAAGGCTACAATGCTA

------------------------------------------------
BGISUSX0002000938   : TGGGATTCTCCCAGGGCGGCCAATTT
rtra19_b19r1.y1     : TGGGATTCTCCCAGGGCGGCCAATTt
recc2813c_j14.y1    : GGGGATTCTCCCAGGGCGGCCAATTt
rcov32b_b19.y1      : TGGGATTCTCCCAGGGCGGCCAATTt

Cited by

ENST00000253546