Sequences

BGISUSX0003059655

Source Seq Type : reads

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>BGISUSX0003059655
CTGCTCTGTGTTGAAGATGGCGAAGACATGCTTGTTTGGACATGAAGCCCTTTTCCACATCACGGATTTTGAGGTTGTCCAGAGGCAGCATGTACTTCTT
CTCTTTCTC

Assemble


--------------------------------------------------------------------------------------------------------------------------
BGISUSX0003059655   : CTGCTCTGTGTTGAAGATGGCGAAGACATGCTTGTTTGGACATGAAGCCCTTTTCCACATCACGGATTTTGAGGTTGTCCAGAGGCAGCATGTACTTCTT
rbh_18883.y1        : CTGCTCTGTGTTGAAGATGGCGAAGACATGCTTGTTTGGACATGAAGCCCTTTTCCACATCACGGATTTTGAGGTTGTCCAGAGGCAGCATGTACTTCTT

-------------------------------
BGISUSX0003059655   : CTCTTTCTC
rbh_18883.y1        : CTCTTTCTC

Cited by

ENST00000359692