Sequences

BGISUSX0000082597

Source Seq Type : all

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>BGISUSX0000082597
CTGCTCTGTGTTGAAGATGGCGAAGACATGCTTGTTTGGACATGAAGCCCTTTTCCACATCACGGATTTTGAGGTTGTCCAGAGGCAGCATGTACTTCTT
CTCTTTCTC

Assemble


--------------------------------------------------------------------------------------------------------------------------
BGISUSX0000082597   : CTGCTCTGTGTTGAAGATGGCGAAGACATGCTTGTTTGGACATGAAGCCCTTTTCCACATCACGGATTTTGAGGTTGTCCAGAGGCAGCATGTACTTCTT
rbh_18883.y1        : CTGCTCTGTGTTGAAGATGGCGAAGACATGCTTGTTtGGACATGAAGCCCTTTTCCACATCACGGATTTTGAGGTTGTCCAGAGGCAGCATGTACTTCTT
BW978477            : ACGAGTACAGGTAGGCCAGCAGCTCATGGTGGATGA*AGGCCTTCGTGTTATTGATCATGAGGTGCATGATGGTCTTTGGCATGAGATCACGGATGGACT

-------------------------------
BGISUSX0000082597   : CTCTTTCTC
rbh_18883.y1        : CTCTTTCTc
BW978477            : TGTTGATGA

Cited by

ENST00000359692