Exon Sequence
>ENSE00000659299 NT
TCCCCACCTCTGATGGCTCC
TCCATGCATCTGGACCTTTG
CCAAGGTGAAGGAATTCAAA
AGCAAGCTGGGCAAAGAGAA
GAACAGCCGTCTGGTGGTGA
AGCGTGGTGAGGTGGTGACC
ATCCGGGTACCTACTCATCC
AGAGGGGAAGCGTGTCTGCT
GGGAGTTTGCGACCGATGAC
TATGACATTGGCTTTGGAGT
TTATTTTGACTGGACCCCTG
TAACTAGCACTGACATAACT
GTGCAGGTCAGTGATTCCAG
TGACGATGAGGATGAAGAAG
AGGAAGAGGAGGAAGAGATT
GAA
>ENSE00000659299 AA
-SPPLMAPPCIWTFAKVKEF
KSKLGKEKNSRLVVKRGEVV
TIRVPTHPEGKRVCWEFATD
DYDIGFGVYFDWTPVTSTDI
TVQVSDSSDDEDEEEEEEEE
IE

ENSE00000659299

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100