Exon Sequence
>ENSE00000659300 NT
ATGGCTAAGTATCAAGTTCC
ACAGAGGTCTGGGGACATCG
TTATGATCCAGTCTGAACAT
ACAGGAGCTATAGATGTTCT
TTCAGCTGATTTGGAATCTG
CAGATCTTCTGGGGGACCAC
AGGAAA
>ENSE00000659300 AA
MAKYQVPQRSGDIVMIQSEH
TGAIDVLSADLESADLLGDH
RK

ENSE00000659300

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100

BGISUSX0003013947 reads Identity : 87.179%

-M--A--K--Y--Q--V--P--Q--R--S--G--D--I--V--M--I--Q--S--E--H--T--G--A--I--D--V--L--S--A--D-
ATGGCTAAGTATCAAGTTCCACAGAGGTCTGGGGACATCGTTATGATCCAGTCTGAACATACAGGAGCTATAGATGTTCTTTCAGCTGAT
      :.:::.:  : :::.: .::::::::::::::::::::::::::::: ::.::.::.:::::.::::::..:::::::::::::
      AGGTACCCCGGTCCGCCAAGGTCTGGGGACATCGTTATGATCCAGTCGGAGCACACGGGAGCCATAGATACTCTTTCAGCTGAT
-------R--Y--P--G--P--P--R--S--G--D--I--V--M--I--Q--S--E--H--T--G--A--I--D--T--L--S--A--D-

-L--E--S--A--D--L--L--G--D--H--R--K--
TTGGAATCTGCAGATCTTCTGGGGGACCACAGGAAAG
.:::::::::::::.::.:::::::::::::::    
CTGGAATCTGCAGACCTCCTGGGGGACCACAGG    
-L--E--S--A--D--L--L--G--D--H--R-----

BGISUSX0001014119 both Identity : 87.179%

-M--A--K--Y--Q--V--P--Q--R--S--G--D--I--V--M--I--Q--S--E--H--T--G--A--I--D--V--L--S--A--D-
ATGGCTAAGTATCAAGTTCCACAGAGGTCTGGGGACATCGTTATGATCCAGTCTGAACATACAGGAGCTATAGATGTTCTTTCAGCTGAT
      :.:::.:  : :::.: .::::::::::::::::::::::::::::: ::.::.::.:::::.::::::..:::::::::::::
      AGGTACCCCGGTCCGCCAAGGTCTGGGGACATCGTTATGATCCAGTCGGAGCACACGGGAGCCATAGATACTCTTTCAGCTGAT
-------R--Y--P--G--P--P--R--S--G--D--I--V--M--I--Q--S--E--H--T--G--A--I--D--T--L--S--A--D-

-L--E--S--A--D--L--L--G--D--H--R--K--
TTGGAATCTGCAGATCTTCTGGGGGACCACAGGAAAG
.:::::::::::::.::.:::::::::::::::    
CTGGAATCTGCAGACCTCCTGGGGGACCACAGG    
-L--E--S--A--D--L--L--G--D--H--R-----

BGISUSX0000018520 all Identity : 87.179%

-M--A--K--Y--Q--V--P--Q--R--S--G--D--I--V--M--I--Q--S--E--H--T--G--A--I--D--V--L--S--A--D-
ATGGCTAAGTATCAAGTTCCACAGAGGTCTGGGGACATCGTTATGATCCAGTCTGAACATACAGGAGCTATAGATGTTCTTTCAGCTGAT
      :.:::.:  : :::.: .::::::::::::::::::::::::::::: ::.::.::.:::::.::::::..:::::::::::::
      AGGTACCCCGGTCCGCCAAGGTCTGGGGACATCGTTATGATCCAGTCGGAGCACACGGGAGCCATAGATACTCTTTCAGCTGAT
-------R--Y--P--G--P--P--R--S--G--D--I--V--M--I--Q--S--E--H--T--G--A--I--D--T--L--S--A--D-

-L--E--S--A--D--L--L--G--D--H--R--K--
TTGGAATCTGCAGATCTTCTGGGGGACCACAGGAAAG
.:::::::::::::.::.:::::::::::::::    
CTGGAATCTGCAGACCTCCTGGGGGACCACAGG    
-L--E--S--A--D--L--L--G--D--H--R-----

BGISUSX0003013947 reads Identity : 66.667%

-M--A--K--Y--Q--V--P--Q--R--S--G--D--I--V--M--I--Q--S--E--H--T--G--A--I--D--V--L--S--A--D-
ATGGCTAAGTATCAAGTTCCACAGAGGTCTGGGGACATCGTTATGATCCAGTCTGAACATACAGGAGCTATAGATGTTCTTTCAGCTGAT
                  ::  .:::::::: .::.                                                      
                  CCCAGGAGGTCTGCAGAT                                                      
-------------------P--R--R--S--A--D-------------------------------------------------------

-L--E--S--A--D--L--L--G--D--H--R--K--
TTGGAATCTGCAGATCTTCTGGGGGACCACAGGAAAG
                                     
                                     
-------------------------------------

BGISUSX0001014119 both Identity : 66.667%

-M--A--K--Y--Q--V--P--Q--R--S--G--D--I--V--M--I--Q--S--E--H--T--G--A--I--D--V--L--S--A--D-
ATGGCTAAGTATCAAGTTCCACAGAGGTCTGGGGACATCGTTATGATCCAGTCTGAACATACAGGAGCTATAGATGTTCTTTCAGCTGAT
                  ::  .:::::::: .::.                                                      
                  CCCAGGAGGTCTGCAGAT                                                      
-------------------P--R--R--S--A--D-------------------------------------------------------

-L--E--S--A--D--L--L--G--D--H--R--K--
TTGGAATCTGCAGATCTTCTGGGGGACCACAGGAAAG
                                     
                                     
-------------------------------------

BGISUSX0000018520 all Identity : 66.667%

-M--A--K--Y--Q--V--P--Q--R--S--G--D--I--V--M--I--Q--S--E--H--T--G--A--I--D--V--L--S--A--D-
ATGGCTAAGTATCAAGTTCCACAGAGGTCTGGGGACATCGTTATGATCCAGTCTGAACATACAGGAGCTATAGATGTTCTTTCAGCTGAT
                  ::  .:::::::: .::.                                                      
                  CCCAGGAGGTCTGCAGAT                                                      
-------------------P--R--R--S--A--D-------------------------------------------------------

-L--E--S--A--D--L--L--G--D--H--R--K--
TTGGAATCTGCAGATCTTCTGGGGGACCACAGGAAAG
                                     
                                     
-------------------------------------