Exon Sequence
>ENSE00000659301 NT
CCACAGATGGTATCTCCAGT
GAGTAAGGATGCCACGGAAG
ATCTGCGGAAAGCAACTGGT
CCTTTGGAGGCTCAGGCCTT
GGTGAAACAGGATTTGCTGC
CTGCAGACCAGGCCCAGGTC
CTCAATGAG
>ENSE00000659301 AA
-PQMVSPVSKDATEDLRKAT
GPLEAQALVKQDLLPADQAQ
VLNE

ENSE00000659301

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100

BGISUSX0003013946 reads Identity : 63.636%

-R--P--Q--M--V--S--P-----V--S--K--D--A--T--E--D--L--R--K--A--T--G--P--L--E--A--Q--A--L--V-
--GCCACAGATGGTATCTCCA---GTGAGTAAGGATGCCACGGAAGATCTGCGGAAAGCAACTGGTCCTTTGGAGGCTCAGGCCTTGGTG
  :::.:::::::::::::::   :  :: .::::::::. :::::..:.::.:::.:::.::::: :. :::::::::::::: :::::
AGGCCGCAGATGGTATCTCCAG--GGNAGGGAGGATGCCGAGGAAGGCCCGCAGAAGGCAGCTGGTGCCGTGGAGGCTCAGGCCATGGTG
-R--P--Q--M--V--S--P--\--X--R--E--D--A--E--E--G--P--Q--K--A--A--G--A--V--E--A--Q--A--M--V-

-K--Q--D--L--L--P--A--D--Q--A--Q--V--L--N--E-
AAACAGGATTTGCTGCCTGCAGACCAGGCCCAGGTCCTCAATGAG
.::::::: :::::::::::::.:::::::::::::::::...::
GAACAGGAATTGCTGCCTGCAGGCCAGGCCCAGGTCCTCAGCAAG
-E--Q--E--L--L--P--A--G--Q--A--Q--V--L--S--K-

BGISUSX0001014114 both Identity : 63.636%

-R--P--Q--M--V--S--P-----V--S--K--D--A--T--E--D--L--R--K--A--T--G--P--L--E--A--Q--A--L--V-
--GCCACAGATGGTATCTCCA---GTGAGTAAGGATGCCACGGAAGATCTGCGGAAAGCAACTGGTCCTTTGGAGGCTCAGGCCTTGGTG
  :::.:::::::::::::::   :  :: .::::::::. :::::..:.::.:::.:::.::::: :. :::::::::::::: :::::
AGGCCGCAGATGGTATCTCCAG--GGNAGGGAGGATGCCGAGGAAGGCCCGCAGAAGGCAGCTGGTGCCGTGGAGGCTCAGGCCATGGTG
-R--P--Q--M--V--S--P--\--X--R--E--D--A--E--E--G--P--Q--K--A--A--G--A--V--E--A--Q--A--M--V-

-K--Q--D--L--L--P--A--D--Q--A--Q--V--L--N--E-
AAACAGGATTTGCTGCCTGCAGACCAGGCCCAGGTCCTCAATGAG
.::::::: :::::::::::::.:::::::::::::::::...::
GAACAGGAATTGCTGCCTGCAGGCCAGGCCCAGGTCCTCAGCAAG
-E--Q--E--L--L--P--A--G--Q--A--Q--V--L--S--K-

BGISUSX0000018518 all Identity : 63.636%

-R--P--Q--M--V--S--P-----V--S--K--D--A--T--E--D--L--R--K--A--T--G--P--L--E--A--Q--A--L--V-
--GCCACAGATGGTATCTCCA---GTGAGTAAGGATGCCACGGAAGATCTGCGGAAAGCAACTGGTCCTTTGGAGGCTCAGGCCTTGGTG
  :::.:::::::::::::::   :  :: .::::::::. :::::..:.::.:::.:::.::::: :. :::::::::::::: :::::
AGGCCGCAGATGGTATCTCCAG--GGNAGGGAGGATGCCGAGGAAGGCCCGCAGAAGGCAGCTGGTGCCGTGGAGGCTCAGGCCATGGTG
-R--P--Q--M--V--S--P--\--X--R--E--D--A--E--E--G--P--Q--K--A--A--G--A--V--E--A--Q--A--M--V-

-K--Q--D--L--L--P--A--D--Q--A--Q--V--L--N--E-
AAACAGGATTTGCTGCCTGCAGACCAGGCCCAGGTCCTCAATGAG
.::::::: :::::::::::::.:::::::::::::::::...::
GAACAGGAATTGCTGCCTGCAGGCCAGGCCCAGGTCCTCAGCAAG
-E--Q--E--L--L--P--A--G--Q--A--Q--V--L--S--K-