Exon Sequence
>ENSE00000669738 NT
CTCAACATCAGCACCTCGGT
TCAGCTGGCAGCCTCCATGC
CTTCAGGATTCCAGCCTGCA
CAGACTCCAGACCCTACGGC
CCCAGTCGCCTACTTCCCAT
ACTTCAACAGGACCTACCTG
GGGGTGGCCGCGTCACTCAA
CGGGGGCAATGTGCTGGCCA
CGTTCGTCCACATGCTGGTT
CAGTGGATGGCAGATCTA
>ENSE00000669738 AA
-LNISTSVQLAASMPSGFQP
AQTPDPTAPVAYFPYFNRTY
LGVAASLNGGNVLATFVHML
VQWMADL

ENSE00000669738

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100

BGISUSX0000152624 all Identity : 92.537%

-V--L--N--I--S--T--S--V--Q--L--A--A--S--M--P--S--G--F--Q--P--A--Q--T--P--D--P--T--A--P--V-
-TTCTCAACATCAGCACCTCGGTTCAGCTGGCAGCCTCCATGCCTTCAGGATTCCAGCCTGCACAGACTCCAGACCCTACGGCCCCAGTC
 :::::::.:::::::::::.::::::::::.:::::::::::::.::: ::::::::: :..::::::::::::::.:::::.::::::
GTTCTCAATATCAGCACCTCAGTTCAGCTGGTAGCCTCCATGCCTCCAGTATTCCAGCCGGTGCAGACTCCAGACCCCACGGCTCCAGTC
-V--L--N--I--S--T--S--V--Q--L--V--A--S--M--P--P--V--F--Q--P--V--Q--T--P--D--P--T--A--P--V-

-A--Y--F--P--Y--F--N--R--T--Y--L--G--V--A--A--S--L--N--G--G--N--V--L--A--T--F--V--H--M--L-
GCCTACTTCCCATACTTCAACAGGACCTACCTGGGGGTGGCCGCGTCACTCAACGGGGGCAATGTGCTGGCCACGTTCGTCCACATGCTG
::::::::::: :::::::::::::::::::::: :::::::::.:::::.::.::::::::.:::::::::::.:::::::::::::::
GCCTACTTCCCCTACTTCAACAGGACCTACCTGGCGGTGGCCGCATCACTTAATGGGGGCAACGTGCTGGCCACATTCGTCCACATGCTG
-A--Y--F--P--Y--F--N--R--T--Y--L--A--V--A--A--S--L--N--G--G--N--V--L--A--T--F--V--H--M--L-

-V--Q--W--M--A--D--L--
GTTCAGTGGATGGCAGATCTAG
::.:::::::::::.:::::: 
GTCCAGTGGATGGCGGATCTA 
-V--Q--W--M--A--D--L--

BGISUSX0003040380 reads Identity : 91.045%

-V--L--N--I--S--T--S--V--Q--L--A--A--S--M--P--S--G--F--Q--P--A--Q--T--P--D--P--T--A--P--V-
-TTCTCAACATCAGCACCTCGGTTCAGCTGGCAGCCTCCATGCCTTCAGGATTCCAGCCTGCACAGACTCCAGACCCTACGGCCCCAGTC
 :::::::.:::::::::::.::::::::::.:::::::::::::.::: ::::::::: :..::::::::::: ::.:::::.::::::
GTTCTCAATATCAGCACCTCAGTTCAGCTGGTAGCCTCCATGCCTCCAGTATTCCAGCCGGTGCAGACTCCAGAACCCACGGCTCCAGTC
-V--L--N--I--S--T--S--V--Q--L--V--A--S--M--P--P--V--F--Q--P--V--Q--T--P--E--P--T--A--P--V-

-A--Y--F--P--Y--F--N--R--T--Y--L--G--V--A--A--S--L--N--G--G--N--V--L--A--T--F--V--H--M--L-
GCCTACTTCCCATACTTCAACAGGACCTACCTGGGGGTGGCCGCGTCACTCAACGGGGGCAATGTGCTGGCCACGTTCGTCCACATGCTG
::::::::::: :::::::::::::::::::::: :::::::::.:::::.::.::::::::.:::::.:::::.:::::::::::::::
GCCTACTTCCCCTACTTCAACAGGACCTACCTGGCGGTGGCCGCATCACTTAATGGGGGCAACGTGCTAGCCACATTCGTCCACATGCTG
-A--Y--F--P--Y--F--N--R--T--Y--L--A--V--A--A--S--L--N--G--G--N--V--L--A--T--F--V--H--M--L-

-V--Q--W--M--A--D--L--
GTTCAGTGGATGGCAGATCTAG
::.:::::::::::.:::::: 
GTCCAGTGGATGGCGGATCTA 
-V--Q--W--M--A--D--L--

BGISUSX0001117519 both Identity : 91.045%

-V--L--N--I--S--T--S--V--Q--L--A--A--S--M--P--S--G--F--Q--P--A--Q--T--P--D--P--T--A--P--V-
-TTCTCAACATCAGCACCTCGGTTCAGCTGGCAGCCTCCATGCCTTCAGGATTCCAGCCTGCACAGACTCCAGACCCTACGGCCCCAGTC
 :::::::.:::::::::::.::::::::::.:::::::::::::.::: ::::::::: :..::::::::::: ::.:::::.::::::
GTTCTCAATATCAGCACCTCAGTTCAGCTGGTAGCCTCCATGCCTCCAGTATTCCAGCCGGTGCAGACTCCAGAACCCACGGCTCCAGTC
-V--L--N--I--S--T--S--V--Q--L--V--A--S--M--P--P--V--F--Q--P--V--Q--T--P--E--P--T--A--P--V-

-A--Y--F--P--Y--F--N--R--T--Y--L--G--V--A--A--S--L--N--G--G--N--V--L--A--T--F--V--H--M--L-
GCCTACTTCCCATACTTCAACAGGACCTACCTGGGGGTGGCCGCGTCACTCAACGGGGGCAATGTGCTGGCCACGTTCGTCCACATGCTG
::::::::::: :::::::::::::::::::::: :::::::::.:::::.::.::::::::.:::::.:::::.:::::::::::::::
GCCTACTTCCCCTACTTCAACAGGACCTACCTGGCGGTGGCCGCATCACTTAATGGGGGCAACGTGCTAGCCACATTCGTCCACATGCTG
-A--Y--F--P--Y--F--N--R--T--Y--L--A--V--A--A--S--L--N--G--G--N--V--L--A--T--F--V--H--M--L-

-V--Q--W--M--A--D--L--
GTTCAGTGGATGGCAGATCTAG
::.:::::::::::.:::::: 
GTCCAGTGGATGGCGGATCTA 
-V--Q--W--M--A--D--L--

BGISUSX0003040380 reads Identity : 42.857%

----L--N--I--S--T--S--V--Q--L--A--A--S--M--P--S--G--F--Q--P--A--Q--T--P--D--P--T--A--P--V-
-TTCTCAACATCAGCACCTCGGTTCAGCTGGCAGCCTCCATGCCTTCAGGATTCCAGCCTGCACAGACTCCAGACCCTACGGCCCCAGTC
                                                                                          
                                                                                          
------------------------------------------------------------------------------------------

-A--Y--F--P--Y--F--N--R--T--Y--L--G--V--A--A--S--L--N--G--G--N--V--L--A--T--F--V--H--M--L-
GCCTACTTCCCATACTTCAACAGGACCTACCTGGGGGTGGCCGCGTCACTCAACGGGGGCAATGTGCTGGCCACGTTCGTCCACATGCTG
                                 ::.::   :.:    .  ::..  :: ....::  :::.::                
                                 GGAGTCTGCACCGGCTGGAATACTGGAGGCATGGAGGCTACC               
----------------------------------G--V--C--T--G--W--N--T--G--G--M--E--A--T----------------

-V--Q--W--M--A--D--L--
GTTCAGTGGATGGCAGATCTAG
                      
                      
----------------------

BGISUSX0001117519 both Identity : 42.857%

----L--N--I--S--T--S--V--Q--L--A--A--S--M--P--S--G--F--Q--P--A--Q--T--P--D--P--T--A--P--V-
-TTCTCAACATCAGCACCTCGGTTCAGCTGGCAGCCTCCATGCCTTCAGGATTCCAGCCTGCACAGACTCCAGACCCTACGGCCCCAGTC
                                                                                          
                                                                                          
------------------------------------------------------------------------------------------

-A--Y--F--P--Y--F--N--R--T--Y--L--G--V--A--A--S--L--N--G--G--N--V--L--A--T--F--V--H--M--L-
GCCTACTTCCCATACTTCAACAGGACCTACCTGGGGGTGGCCGCGTCACTCAACGGGGGCAATGTGCTGGCCACGTTCGTCCACATGCTG
                                 ::.::   :.:    .  ::..  :: ....::  :::.::                
                                 GGAGTCTGCACCGGCTGGAATACTGGAGGCATGGAGGCTACC               
----------------------------------G--V--C--T--G--W--N--T--G--G--M--E--A--T----------------

-V--Q--W--M--A--D--L--
GTTCAGTGGATGGCAGATCTAG
                      
                      
----------------------

BGISUSX0000152624 all Identity : 42.857%

----L--N--I--S--T--S--V--Q--L--A--A--S--M--P--S--G--F--Q--P--A--Q--T--P--D--P--T--A--P--V-
-TTCTCAACATCAGCACCTCGGTTCAGCTGGCAGCCTCCATGCCTTCAGGATTCCAGCCTGCACAGACTCCAGACCCTACGGCCCCAGTC
                                                                                          
                                                                                          
------------------------------------------------------------------------------------------

-A--Y--F--P--Y--F--N--R--T--Y--L--G--V--A--A--S--L--N--G--G--N--V--L--A--T--F--V--H--M--L-
GCCTACTTCCCATACTTCAACAGGACCTACCTGGGGGTGGCCGCGTCACTCAACGGGGGCAATGTGCTGGCCACGTTCGTCCACATGCTG
                                 ::.::   :.:    .  ::..  :: ....::  :::.::                
                                 GGAGTCTGCACCGGCTGGAATACTGGAGGCATGGAGGCTACC               
----------------------------------G--V--C--T--G--W--N--T--G--G--M--E--A--T----------------

-V--Q--W--M--A--D--L--
GTTCAGTGGATGGCAGATCTAG
                      
                      
----------------------