Exon Sequence
>ENSE00000669741 NT
TGTGAATGGACAGAGGGAGG
GATTACCCCGGTGTTCGAGC
CCCGAGCTGTTAGCCACCTG
GTCACGTGGCAGGATGGCCG
ATGTAGCAGCGAATTCCTGG
CCTCTCTGCCCCAGCCGAAG
TCTCATCTCAGTGTGGCCAC
GGGCTTCGGCTGTGCAACCA
TCTTCTGGCTTTTGAAATAT
>ENSE00000669741 AA
-CEWTEGGITPVFEPRAVSH
LVTWQDGRCSSEFLASLPQP
KSHLSVATGFGCATIFWLLK
Y

ENSE00000669741

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100