Exon Sequence
>ENSE00000887375 NT
ATGGAGAGCAGAGGCCCACT
GGCTACCTCGCGCCTGCTGC
TGTTGCTGCTGTTGCTACTA
CTGCGTCACACCCGCCAGGG
ATGGGCCCTGAGACCTGTTC
TCCCCACCCAG
>ENSE00000887375 AA
MESRGPLATSRLLLLLLLLL
LRHTRQGWALRPVLPTQ

ENSE00000887375

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100