Exon Sequence
>ENSE00000888266 NT
GAGAAAGAGAAGAAGTACAT
GCTGCCTCTGGACAACCTCA
AGATCCGTGATGTGGAGAAG
GGCTTCATGTCCAACAAGCA
CGTCTTCGCCATCTTCAACA
CGGAGCAG
>ENSE00000888266 AA
EKEKKYMLPLDNLKIRDVEK
GFMSNKHVFAIFNTEQ

ENSE00000888266

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100

BGISUSX0003059655 reads Identity : 100%

-E--K--E--K--K--Y--M--L--P--L--D--N--L--K--I--R--D--V--E--K--G--F--M--S-----N--K--H--V--F-
GAGAAAGAGAAGAAGTACATGCTGCCTCTGGACAACCTCAAGATCCGTGATGTGGAGAAGGGCTTCATGTCC---AACAAGCACGTCTTC
:::::::::::::::::::::::::::::::::::::::::.::::::::::::::.:::::::::::::::   ::::::::.::::::
GAGAAAGAGAAGAAGTACATGCTGCCTCTGGACAACCTCAAAATCCGTGATGTGGAAAAGGGCTTCATGTCCA--AACAAGCATGTCTTC
-E--K--E--K--K--Y--M--L--P--L--D--N--L--K--I--R--D--V--E--K--G--F--M--S--\--N--K--H--V--F-

-A--I--F--N--T--E--Q---
GCCATCTTCAACACGGAGCAGAG
::::::::::::::.::::::  
GCCATCTTCAACACAGAGCAG  
-A--I--F--N--T--E--Q---

BGISUSX0001064334 both Identity : 100%

-E--K--E--K--K--Y--M--L--P--L--D--N--L--K--I--R--D--V--E--K--G--F--M--S-----N--K--H--V--F-
GAGAAAGAGAAGAAGTACATGCTGCCTCTGGACAACCTCAAGATCCGTGATGTGGAGAAGGGCTTCATGTCC---AACAAGCACGTCTTC
:::::::::::::::::::::::::::::::::::::::::.::::::::::::::.:::::::::::::::   ::::::::.::::::
GAGAAAGAGAAGAAGTACATGCTGCCTCTGGACAACCTCAAAATCCGTGATGTGGAAAAGGGCTTCATGTCCA--AACAAGCATGTCTTC
-E--K--E--K--K--Y--M--L--P--L--D--N--L--K--I--R--D--V--E--K--G--F--M--S--\--N--K--H--V--F-

-A--I--F--N--T--E--Q---
GCCATCTTCAACACGGAGCAGAG
::::::::::::::.::::::  
GCCATCTTCAACACAGAGCAG  
-A--I--F--N--T--E--Q---

BGISUSX0000082597 all Identity : 100%

-E--K--E--K--K--Y--M--L--P--L--D--N--L--K--I--R--D--V--E--K--G--F--M--S-----N--K--H--V--F-
GAGAAAGAGAAGAAGTACATGCTGCCTCTGGACAACCTCAAGATCCGTGATGTGGAGAAGGGCTTCATGTCC---AACAAGCACGTCTTC
:::::::::::::::::::::::::::::::::::::::::.::::::::::::::.:::::::::::::::   ::::::::.::::::
GAGAAAGAGAAGAAGTACATGCTGCCTCTGGACAACCTCAAAATCCGTGATGTGGAAAAGGGCTTCATGTCCA--AACAAGCATGTCTTC
-E--K--E--K--K--Y--M--L--P--L--D--N--L--K--I--R--D--V--E--K--G--F--M--S--\--N--K--H--V--F-

-A--I--F--N--T--E--Q---
GCCATCTTCAACACGGAGCAGAG
::::::::::::::.::::::  
GCCATCTTCAACACAGAGCAG  
-A--I--F--N--T--E--Q---