Exon Sequence
>ENSE00000941994 NT
GATGAGGATGAAGAAGTATA
CAAGAGAGATTTCAGCGCTC
CTACCCTGGAGGATCATTTC
AATAAAACCATTCTTCCTAA
AGTCATGCAG
>ENSE00000941994 AA
DEDEEVYKRDFSAPTLEDHF
NKTILPKVMQ

ENSE00000941994

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100

BGISUSX0002049260 est Identity : 100%

-D--E--D--E--E--V--Y--K--R--D--F--S--A--P--T--L--E--D--H--F--N--K--T--I--L--P--K--V--M--Q-
GATGAGGATGAAGAAGTATACAAGAGAGATTTCAGCGCTCCTACCCTGGAGGATCATTTCAATAAAACCATTCTTCCTAAAGTCATGCAG
:::::::::::::::::::::::::::::::::::.:: :::::::::::::::::::::::.::::::::::::::.::::::::::::
GATGAGGATGAAGAAGTATACAAGAGAGATTTCAGTGCACCTACCCTGGAGGATCATTTCAACAAAACCATTCTTCCCAAAGTCATGCAG
-D--E--D--E--E--V--Y--K--R--D--F--S--A--P--T--L--E--D--H--F--N--K--T--I--L--P--K--V--M--Q-

BGISUSX0001032430 both Identity : 100%

-D--E--D--E--E--V--Y--K--R--D--F--S--A--P--T--L--E--D--H--F--N--K--T--I--L--P--K--V--M--Q-
GATGAGGATGAAGAAGTATACAAGAGAGATTTCAGCGCTCCTACCCTGGAGGATCATTTCAATAAAACCATTCTTCCTAAAGTCATGCAG
:::::::::::::::::::::::::::::::::::.:: :::::::::::::::::::::::.::::::::::::::.::::::::::::
GATGAGGATGAAGAAGTATACAAGAGAGATTTCAGTGCACCTACCCTGGAGGATCATTTCAACAAAACCATTCTTCCCAAAGTCATGCAG
-D--E--D--E--E--V--Y--K--R--D--F--S--A--P--T--L--E--D--H--F--N--K--T--I--L--P--K--V--M--Q-

BGISUSX0000042438 all Identity : 100%

-D--E--D--E--E--V--Y--K--R--D--F--S--A--P--T--L--E--D--H--F--N--K--T--I--L--P--K--V--M--Q-
GATGAGGATGAAGAAGTATACAAGAGAGATTTCAGCGCTCCTACCCTGGAGGATCATTTCAATAAAACCATTCTTCCTAAAGTCATGCAG
:::::::::::::::::::::::::::::::::::.:: :::::::::::::::::::::::.::::::::::::::.::::::::::::
GATGAGGATGAAGAAGTATACAAGAGAGATTTCAGTGCACCTACCCTGGAGGATCATTTCAACAAAACCATTCTTCCCAAAGTCATGCAG
-D--E--D--E--E--V--Y--K--R--D--F--S--A--P--T--L--E--D--H--F--N--K--T--I--L--P--K--V--M--Q-