Exon Sequence
>ENSE00000966778 NT
TGGAAGCCTCGGAACCTGAA
CATCAGCCAGCATGGCTCGG
ACATGCAGGTGTCCTTCGAC
CATGCACCGCACAACTTCGG
CTTCCGTTTCTTCTATCTTC
ACTACAAGCTCAAGCACGAA
GGACCTTTCAAGCGAAAGAC
CTGTAAGCAG
>ENSE00000966778 AA
-WKPRNLNISQHGSDMQVSF
DHAPHNFGFRFFYLHYKLKH
EGPFKRKTCKQ

ENSE00000966778

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100

BGISUSX0000133328 all Identity : 94.118%

-F--W--K--P--R--N--L--N--I--S--Q--H--G--S--D--M--Q--V--S--F--D--H--A--P--H--N--F--G--F--R-
-TCTGGAAGCCTCGGAACCTGAACATCAGCCAGCATGGCTCGGACATGCAGGTGTCCTTCGACCATGCACCGCACAACTTCGGCTTCCGT
 ::::::::::::::::::: ::::::: :::.::::::::.:::::::::::::::::::::::.::.::.::.: :::::::::::::
TTCTGGAAGCCTCGGAACCTCAACATCACCCAACATGGCTCAGACATGCAGGTGTCCTTCGACCACGCGCCACATACCTTCGGCTTCCGT
-F--W--K--P--R--N--L--N--I--T--Q--H--G--S--D--M--Q--V--S--F--D--H--A--P--H--T--F--G--F--R-

-F--F--Y--L--H--Y--K--L--K--H--E--G--P--F--K--R--K--T--C--K--Q-
TTCTTCTATCTTCACTACAAGCTCAAGCACGAAGGACCTTTCAAGCGAAAGACCTGTAAGCAG
:::::.:::::::::::::::::::::::::::::::..:::::.:::::::::::.::.:::
TTCTTTTATCTTCACTACAAGCTCAAGCACGAAGGACTCTTCAAACGAAAGACCTGCAAACAG
-F--F--Y--L--H--Y--K--L--K--H--E--G--L--F--K--R--K--T--C--K--Q-