Exon Sequence
>ENSE00000966781 NT
CACTCCCCGTGGGCCGGGCC
CATCAGAGCCGTGGCCATCA
CAGTGCCACTGGTAGTCATA
TCGGCATTCGCGACGCTCTT
CACTGTGATGTGCCGCAAGA
AGCAACAA
>ENSE00000966781 AA
-HSPWAGPIRAVAITVPLVV
ISAFATLFTVMCRKKQQ

ENSE00000966781

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100