Exon Sequence
>ENSE00000966782 NT
AATATATATTCACATTTAGA
TGAAGAGAGCTCTGAGTCTT
CCACATACACTGCAGCACTC
CCAAGAGAGAGGCTCCGGCC
GCGGCCGAAGGTCTTTCTCT
GCTATTCCAGTAAAGATGGC
CAGAATCACATGAATGTCGT
CCAGTGTTTCGCCTACTTCC
TCCAGGACTTCTGTGGCTGT
GAG
>ENSE00000966782 AA
-NIYSHLDEESSESSTYTAA
LPRERLRPRPKVFLCYSSKD
GQNHMNVVQCFAYFLQDFCG
CE

ENSE00000966782

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100