Exon Sequence
>ENSE00000973893 NT
ACAACAGAACAACCACCTCC
AAGGTCTTGGATTATGTTAC
AAGAACCAGATAGGACAAGG
CCAACT
>ENSE00000973893 AA
-TTEQPPPRSWIMLQEPDRT
RPT

ENSE00000973893

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100

BGISUSX0000018327 all Identity : 100%

----T--T--E--Q--P--P--P--R--S--W--I--M--L--Q--E--P--D--R--T--R--P--T--
-TTACAACAGAACAACCACCTCCAAGGTCTTGGATTATGTTACAAGAACCAGATAGGACAAGGCCAACTG
                     :::::.::::::                                     
                     CCAAGATCTTGG                                     
----------------------P--R--S--W--------------------------------------

BGISUSX0000018327 all Identity : 95.238%

----T--T--E--Q--P--P--P--R--S--W--I--M--L--Q--E--P--D--R--T--R--P--T--
-TTACAACAGAACAACCACCTCCAAGGTCTTGGATTATGTTACAAGAACCAGATAGGACAAGGCCAACTG
    ::::::::::::::::::::::.::::::::::::::::::::::::::.::.::  :::::    
   TCAACAGAACAACCACCTCCAAGATCTTGGATTATGTTACAAGAACCAGACAGAACTCGGCCA    
----S--T--E--Q--P--P--P--R--S--W--I--M--L--Q--E--P--D--R--T--R--P-----