Exon Sequence
>ENSE00000973894 NT
TTGTTTTCTGTCATGTGCTA
TAATGTTCTTTGTGATAAAT
ATGCGACCCGGCAGTTATAC
GGCTACTGTCCATCATGGGC
GCTAAACTGGGACTACAGGA
AAAAGGCCATTATTCAAGAA
ATCTTGAGCTGCAATGCTGA
TATCGTAAGTCTTCAG
>ENSE00000973894 AA
-LFSVMCYNVLCDKYATRQL
YGYCPSWALNWDYRKKAIIQ
EILSCNADIVSLQ

ENSE00000973894

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100

BGISUSX0003013853 reads Identity : 100%

-A--L--F--S--V--M--C--Y--N--V--L--C--D--K--Y--A--T--R--Q--L--Y--G--Y--C--P--S--W--A--L--N-
-CCTTGTTTTCTGTCATGTGCTATAATGTTCTTTGTGATAAATATGCGACCCGGCAGTTATACGGCTACTGTCCATCATGGGCGCTAAAC
 :::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::.::::::::::::::::::::.      
GCCTTGTTTTCTGTCATGTGCTATAATGTTCTTTGTGATAAATATGCGACCCGGCAGTTATATGGCTACTGTCCATCATGGGCA      
-A--L--F--S--V--M--C--Y--N--V--L--C--D--K--Y--A--T--R--Q--L--Y--G--Y--C--P--S--W--A-------

-W--D--Y--R--K--K--A--I--I--Q--E--I--L--S--C--N--A--D--I--V--S--L--Q-
TGGGACTACAGGAAAAAGGCCATTATTCAAGAAATCTTGAGCTGCAATGCTGATATCGTAAGTCTTCAG
                                                                     
                                                                     
---------------------------------------------------------------------

BGISUSX0001013955 both Identity : 100%

-A--L--F--S--V--M--C--Y--N--V--L--C--D--K--Y--A--T--R--Q--L--Y--G--Y--C--P--S--W--A--L--N-
-CCTTGTTTTCTGTCATGTGCTATAATGTTCTTTGTGATAAATATGCGACCCGGCAGTTATACGGCTACTGTCCATCATGGGCGCTAAAC
 :::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::.::::::::::::::::::::.      
GCCTTGTTTTCTGTCATGTGCTATAATGTTCTTTGTGATAAATATGCGACCCGGCAGTTATATGGCTACTGTCCATCATGGGCA      
-A--L--F--S--V--M--C--Y--N--V--L--C--D--K--Y--A--T--R--Q--L--Y--G--Y--C--P--S--W--A-------

-W--D--Y--R--K--K--A--I--I--Q--E--I--L--S--C--N--A--D--I--V--S--L--Q-
TGGGACTACAGGAAAAAGGCCATTATTCAAGAAATCTTGAGCTGCAATGCTGATATCGTAAGTCTTCAG
                                                                     
                                                                     
---------------------------------------------------------------------

BGISUSX0000018333 all Identity : 100%

-A--L--F--S--V--M--C--Y--N--V--L--C--D--K--Y--A--T--R--Q--L--Y--G--Y--C--P--S--W--A--L--N-
-CCTTGTTTTCTGTCATGTGCTATAATGTTCTTTGTGATAAATATGCGACCCGGCAGTTATACGGCTACTGTCCATCATGGGCGCTAAAC
 :::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::.::::::::::::::::::::.      
GCCTTGTTTTCTGTCATGTGCTATAATGTTCTTTGTGATAAATATGCGACCCGGCAGTTATATGGCTACTGTCCATCATGGGCA      
-A--L--F--S--V--M--C--Y--N--V--L--C--D--K--Y--A--T--R--Q--L--Y--G--Y--C--P--S--W--A-------

-W--D--Y--R--K--K--A--I--I--Q--E--I--L--S--C--N--A--D--I--V--S--L--Q-
TGGGACTACAGGAAAAAGGCCATTATTCAAGAAATCTTGAGCTGCAATGCTGATATCGTAAGTCTTCAG
                                                                     
                                                                     
---------------------------------------------------------------------

BGISUSX0003013852 reads Identity : 95.833%

----L--F--S--V--M--C--Y--N--V--L--C--D--K--Y--A--T--R--Q--L--Y--G--Y--C--P--S--W--A--L--N-
-CCTTGTTTTCTGTCATGTGCTATAATGTTCTTTGTGATAAATATGCGACCCGGCAGTTATACGGCTACTGTCCATCATGGGCGCTAAAC
                                                                                       ::.
                                                                                       AAT
----------------------------------------------------------------------------------------N-

-W--D--Y--R--K--K--A--I--I--Q--E--I--L--S--C--N--A--D--I--V--S--L--Q-
TGGGACTACAGGAAAAAGGCCATTATTCAAGAAATCTTGAGCTGCAATGCTGATATCGTAAGTCTTCAG
:::::::::::::::::::::::::::::::::::::::::.::.:::::::::::..:::::::::::
TGGGACTACAGGAAAAAGGCCATTATTCAAGAAATCTTGAGTTGTAATGCTGATATTATAAGTCTTCAG
-W--D--Y--R--K--K--A--I--I--Q--E--I--L--S--C--N--A--D--I--I--S--L--Q-

BGISUSX0001013954 both Identity : 95.833%

----L--F--S--V--M--C--Y--N--V--L--C--D--K--Y--A--T--R--Q--L--Y--G--Y--C--P--S--W--A--L--N-
-CCTTGTTTTCTGTCATGTGCTATAATGTTCTTTGTGATAAATATGCGACCCGGCAGTTATACGGCTACTGTCCATCATGGGCGCTAAAC
                                                                                       ::.
                                                                                       AAT
----------------------------------------------------------------------------------------N-

-W--D--Y--R--K--K--A--I--I--Q--E--I--L--S--C--N--A--D--I--V--S--L--Q-
TGGGACTACAGGAAAAAGGCCATTATTCAAGAAATCTTGAGCTGCAATGCTGATATCGTAAGTCTTCAG
:::::::::::::::::::::::::::::::::::::::::.::.:::::::::::..:::::::::::
TGGGACTACAGGAAAAAGGCCATTATTCAAGAAATCTTGAGTTGTAATGCTGATATTATAAGTCTTCAG
-W--D--Y--R--K--K--A--I--I--Q--E--I--L--S--C--N--A--D--I--I--S--L--Q-

BGISUSX0000018332 all Identity : 95.833%

----L--F--S--V--M--C--Y--N--V--L--C--D--K--Y--A--T--R--Q--L--Y--G--Y--C--P--S--W--A--L--N-
-CCTTGTTTTCTGTCATGTGCTATAATGTTCTTTGTGATAAATATGCGACCCGGCAGTTATACGGCTACTGTCCATCATGGGCGCTAAAC
                                                                                       ::.
                                                                                       AAT
----------------------------------------------------------------------------------------N-

-W--D--Y--R--K--K--A--I--I--Q--E--I--L--S--C--N--A--D--I--V--S--L--Q-
TGGGACTACAGGAAAAAGGCCATTATTCAAGAAATCTTGAGCTGCAATGCTGATATCGTAAGTCTTCAG
:::::::::::::::::::::::::::::::::::::::::.::.:::::::::::..:::::::::::
TGGGACTACAGGAAAAAGGCCATTATTCAAGAAATCTTGAGTTGTAATGCTGATATTATAAGTCTTCAG
-W--D--Y--R--K--K--A--I--I--Q--E--I--L--S--C--N--A--D--I--I--S--L--Q-

BGISUSX0003013853 reads Identity : 50%

----L--F--S--V--M--C--Y--N--V--L--C--D--K--Y--A--T--R--Q--L--Y--G--Y--C--P--S--W--A--L--N-
-CCTTGTTTTCTGTCATGTGCTATAATGTTCTTTGTGATAAATATGCGACCCGGCAGTTATACGGCTACTGTCCATCATGGGCGCTAAAC
                                                                     ::.:::: ::::.:. ::   
                                                                     TGCCCATGATGGACAGTA   
----------------------------------------------------------------------C--P--*--W--T--V----

-W--D--Y--R--K--K--A--I--I--Q--E--I--L--S--C--N--A--D--I--V--S--L--Q-
TGGGACTACAGGAAAAAGGCCATTATTCAAGAAATCTTGAGCTGCAATGCTGATATCGTAAGTCTTCAG
                                                                     
                                                                     
---------------------------------------------------------------------

BGISUSX0001013955 both Identity : 50%

----L--F--S--V--M--C--Y--N--V--L--C--D--K--Y--A--T--R--Q--L--Y--G--Y--C--P--S--W--A--L--N-
-CCTTGTTTTCTGTCATGTGCTATAATGTTCTTTGTGATAAATATGCGACCCGGCAGTTATACGGCTACTGTCCATCATGGGCGCTAAAC
                                                                     ::.:::: ::::.:. ::   
                                                                     TGCCCATGATGGACAGTA   
----------------------------------------------------------------------C--P--*--W--T--V----

-W--D--Y--R--K--K--A--I--I--Q--E--I--L--S--C--N--A--D--I--V--S--L--Q-
TGGGACTACAGGAAAAAGGCCATTATTCAAGAAATCTTGAGCTGCAATGCTGATATCGTAAGTCTTCAG
                                                                     
                                                                     
---------------------------------------------------------------------

BGISUSX0000018333 all Identity : 50%

----L--F--S--V--M--C--Y--N--V--L--C--D--K--Y--A--T--R--Q--L--Y--G--Y--C--P--S--W--A--L--N-
-CCTTGTTTTCTGTCATGTGCTATAATGTTCTTTGTGATAAATATGCGACCCGGCAGTTATACGGCTACTGTCCATCATGGGCGCTAAAC
                                                                     ::.:::: ::::.:. ::   
                                                                     TGCCCATGATGGACAGTA   
----------------------------------------------------------------------C--P--*--W--T--V----

-W--D--Y--R--K--K--A--I--I--Q--E--I--L--S--C--N--A--D--I--V--S--L--Q-
TGGGACTACAGGAAAAAGGCCATTATTCAAGAAATCTTGAGCTGCAATGCTGATATCGTAAGTCTTCAG
                                                                     
                                                                     
---------------------------------------------------------------------